ID: 992358473

View in Genome Browser
Species Human (GRCh38)
Location 5:76010325-76010347
Sequence CTAATTATCCAGGGAAAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992358464_992358473 16 Left 992358464 5:76010286-76010308 CCTTCATGCCTGCTCGTCAGGGT No data
Right 992358473 5:76010325-76010347 CTAATTATCCAGGGAAAAGACGG No data
992358469_992358473 8 Left 992358469 5:76010294-76010316 CCTGCTCGTCAGGGTGGGGGATC No data
Right 992358473 5:76010325-76010347 CTAATTATCCAGGGAAAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992358473 Original CRISPR CTAATTATCCAGGGAAAAGA CGG Intergenic
No off target data available for this crispr