ID: 992360040

View in Genome Browser
Species Human (GRCh38)
Location 5:76028133-76028155
Sequence CAGTTTCCAAGCCATGATGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992360040_992360044 9 Left 992360040 5:76028133-76028155 CCCGCATCATGGCTTGGAAACTG No data
Right 992360044 5:76028165-76028187 TTCAGCTTGGAAACAACCATAGG No data
992360040_992360042 -4 Left 992360040 5:76028133-76028155 CCCGCATCATGGCTTGGAAACTG No data
Right 992360042 5:76028152-76028174 ACTGTCTTCCAGCTTCAGCTTGG No data
992360040_992360045 10 Left 992360040 5:76028133-76028155 CCCGCATCATGGCTTGGAAACTG No data
Right 992360045 5:76028166-76028188 TCAGCTTGGAAACAACCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992360040 Original CRISPR CAGTTTCCAAGCCATGATGC GGG (reversed) Intergenic
No off target data available for this crispr