ID: 992364093

View in Genome Browser
Species Human (GRCh38)
Location 5:76074091-76074113
Sequence AGCCAGAGCCTTCACTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992364093_992364098 18 Left 992364093 5:76074091-76074113 CCTCTGCAGTGAAGGCTCTGGCT No data
Right 992364098 5:76074132-76074154 TGAGACACACGAACAGGCAAAGG No data
992364093_992364097 12 Left 992364093 5:76074091-76074113 CCTCTGCAGTGAAGGCTCTGGCT No data
Right 992364097 5:76074126-76074148 TTGATTTGAGACACACGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992364093 Original CRISPR AGCCAGAGCCTTCACTGCAG AGG (reversed) Intergenic
No off target data available for this crispr