ID: 992365693

View in Genome Browser
Species Human (GRCh38)
Location 5:76086874-76086896
Sequence TACTGCTGTCCCTAATTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992365693_992365695 -7 Left 992365693 5:76086874-76086896 CCTCCTAATTAGGGACAGCAGTA 0: 1
1: 0
2: 0
3: 3
4: 66
Right 992365695 5:76086890-76086912 AGCAGTAGTATTTGCACTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 131
992365693_992365696 -3 Left 992365693 5:76086874-76086896 CCTCCTAATTAGGGACAGCAGTA 0: 1
1: 0
2: 0
3: 3
4: 66
Right 992365696 5:76086894-76086916 GTAGTATTTGCACTTGAGGATGG 0: 1
1: 0
2: 1
3: 7
4: 122
992365693_992365697 13 Left 992365693 5:76086874-76086896 CCTCCTAATTAGGGACAGCAGTA 0: 1
1: 0
2: 0
3: 3
4: 66
Right 992365697 5:76086910-76086932 AGGATGGCTTACCTATTGAGAGG 0: 1
1: 0
2: 1
3: 2
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992365693 Original CRISPR TACTGCTGTCCCTAATTAGG AGG (reversed) Intronic
909438294 1:75669510-75669532 CACTACTGTCCCAACTTAGGAGG + Intergenic
910762425 1:90747159-90747181 TACTGCTGTTACCAATTAAGTGG + Intergenic
911075710 1:93872418-93872440 TAATCCTGTCCCTAATTTAGCGG - Intronic
913672420 1:121110154-121110176 TTGTGCTGTCCCTAATTTAGAGG + Intergenic
914024187 1:143897518-143897540 TTGTGCTGTCCCTAATTTAGAGG + Intergenic
914662676 1:149805545-149805567 TTGTGCTGTCCCTAATTTAGAGG + Intronic
923537402 1:234863605-234863627 TTCTGCAGTCCTTAATTATGGGG - Intergenic
1062985165 10:1761625-1761647 AACTCATGTCCCTAGTTAGGAGG - Intergenic
1067859819 10:49834389-49834411 TACTGCTGTCTCTAAATAACTGG + Intronic
1068908913 10:62357692-62357714 TACAGCTGTCCCTTTTCAGGTGG - Intergenic
1082105984 11:48222440-48222462 TGCTGCTGACCCTGATTAAGAGG - Intergenic
1088402508 11:109436669-109436691 TCCTGCAGTCCCTAATCAGTAGG + Intergenic
1094097352 12:26722090-26722112 TACTTTTTTGCCTAATTAGGAGG - Intronic
1108722268 13:53144440-53144462 TAGTGCTGTCCTTAGTTAGAAGG + Intergenic
1110516070 13:76413891-76413913 TACCGCTGTGCCTCACTAGGTGG + Intergenic
1116574127 14:46551598-46551620 TTATGCTGCTCCTAATTAGGGGG - Intergenic
1120831489 14:89001230-89001252 TATTGTTGTCCCTCATTTGGGGG + Intergenic
1121025434 14:90612592-90612614 TGGTGCTGTCACTAATGAGGAGG + Intronic
1121492751 14:94371855-94371877 TCCTGCTGTCCCTCCTCAGGAGG + Intergenic
1146283824 17:31561095-31561117 TACTGTTGTCCCTGTTTTGGGGG + Intergenic
1149813619 17:59702412-59702434 TAATGCTGTCGCTAATTAGACGG + Intronic
1149977887 17:61284883-61284905 TTCTGCTGTCCCTTCTGAGGTGG - Intronic
1157056625 18:44236807-44236829 TACTGCTCTCACTAATTATTTGG + Intergenic
1159620730 18:70635345-70635367 TATTGCTGTCCCTACTTAACAGG - Intronic
929746236 2:44662024-44662046 TACAGCTGTCCCAAATCATGAGG - Intronic
930583076 2:53235629-53235651 TACTGTTGTCCCTCAATTGGAGG - Intergenic
1174552595 20:51372704-51372726 GACAGCTGTACCTACTTAGGGGG + Intergenic
1175365995 20:58456558-58456580 CACTGCTCTCCCCAAATAGGAGG - Intergenic
1179269454 21:39839501-39839523 TTCTACTGTCCCTAATTTGTGGG + Intergenic
1183479893 22:38057655-38057677 CACTGCTGTCCCGTATGAGGTGG + Intronic
949866041 3:8548556-8548578 TACTGCAGTCCCTAGGGAGGAGG - Exonic
954037977 3:47863342-47863364 TACAGCTCTCCCTCCTTAGGTGG + Intronic
954897617 3:53990152-53990174 TACAGCTGTGCTTTATTAGGGGG - Intergenic
960795608 3:121483802-121483824 TAATGCTCTACTTAATTAGGTGG + Intronic
964682983 3:159362802-159362824 TACTGCTGTCTCTACACAGGTGG + Intronic
964832269 3:160897386-160897408 TCCTGATGTCTCTAACTAGGTGG + Intronic
966355703 3:179076360-179076382 TACAGCTGTCCCTCAGTATGTGG - Intergenic
971606843 4:28668831-28668853 TACTGCTGTCCCTCATGCTGCGG + Intergenic
972644981 4:40959007-40959029 TATTGCTGTCACTCATTAGGTGG - Intronic
974779401 4:66533074-66533096 TAATACTGTCTCTAACTAGGTGG - Intergenic
983967710 4:173833282-173833304 TTCTGCTGTCCCCAAATTGGAGG - Intergenic
992365693 5:76086874-76086896 TACTGCTGTCCCTAATTAGGAGG - Intronic
997309900 5:132871055-132871077 TTTTGCTGTCCCTAAGCAGGAGG - Intergenic
998628020 5:143867543-143867565 CACTGCTGTCTCTAATTCTGTGG + Intergenic
1003702517 6:8484347-8484369 TACTGTTGTCCCTAACAAAGTGG + Intergenic
1004850502 6:19693731-19693753 TACTGTCGTCCCAAACTAGGGGG - Intergenic
1007192304 6:40029936-40029958 TCCAGCTGTCCCTCATTTGGTGG + Intergenic
1023121025 7:36908787-36908809 TGATACTGTACCTAATTAGGTGG - Intronic
1028727057 7:94100026-94100048 TACTGCTTTACATAATTAGAAGG - Intergenic
1028900197 7:96090471-96090493 TATTTCTTTCCTTAATTAGGTGG + Intronic
1031533661 7:122907840-122907862 TACTGCTTTCCCAGAGTAGGTGG + Intergenic
1031903775 7:127439056-127439078 TACTCCTATCCCAAATTATGCGG - Intergenic
1033101489 7:138476616-138476638 TAATGCTGTACCTATTTTGGGGG - Intronic
1034050458 7:147978600-147978622 TAATGGTGCCCTTAATTAGGAGG - Intronic
1040877789 8:52170966-52170988 TACTCCTCTCCCTAATTTTGTGG + Intronic
1041545735 8:59040430-59040452 TACTGCTGTACCTAATTTGAGGG - Intronic
1042658451 8:71127384-71127406 TACTGTTGTCCCTCAATAGATGG + Intergenic
1043254288 8:78113803-78113825 TATTCCTGTCACTAATTGGGGGG - Intergenic
1044780806 8:95741505-95741527 TGCTGCTCTACCTTATTAGGTGG + Intergenic
1046255710 8:111694179-111694201 CACTGCTGTCCCAAGCTAGGGGG + Intergenic
1055847528 9:80584854-80584876 TACTGATGTCTTTAATTATGTGG - Intergenic
1058037107 9:100264890-100264912 TGCTGCTTTCCCTAATCAGATGG + Exonic
1058063277 9:100522205-100522227 TACTGCCATCTCTGATTAGGAGG - Intronic
1059861068 9:118462577-118462599 TATTGCTGGCCCTAATTATCAGG + Intergenic
1059861300 9:118465928-118465950 TATTGCTGGCCCTAATTATCAGG + Intergenic
1186472657 X:9833513-9833535 TTATGAGGTCCCTAATTAGGAGG - Intronic
1186677118 X:11830012-11830034 TACTGCTTTCCCTTATAAAGTGG + Intergenic
1189098034 X:38160560-38160582 TCCTGGTGGCCCAAATTAGGGGG + Intronic
1190035523 X:47019788-47019810 TACTGCTGTGCCAACTAAGGAGG - Intronic
1194622141 X:96186541-96186563 TCTTGCTGTTCATAATTAGGAGG - Intergenic