ID: 992365695

View in Genome Browser
Species Human (GRCh38)
Location 5:76086890-76086912
Sequence AGCAGTAGTATTTGCACTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992365693_992365695 -7 Left 992365693 5:76086874-76086896 CCTCCTAATTAGGGACAGCAGTA 0: 1
1: 0
2: 0
3: 3
4: 66
Right 992365695 5:76086890-76086912 AGCAGTAGTATTTGCACTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 131
992365694_992365695 -10 Left 992365694 5:76086877-76086899 CCTAATTAGGGACAGCAGTAGTA 0: 1
1: 0
2: 1
3: 3
4: 76
Right 992365695 5:76086890-76086912 AGCAGTAGTATTTGCACTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 131
992365692_992365695 -6 Left 992365692 5:76086873-76086895 CCCTCCTAATTAGGGACAGCAGT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 992365695 5:76086890-76086912 AGCAGTAGTATTTGCACTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 131
992365691_992365695 -5 Left 992365691 5:76086872-76086894 CCCCTCCTAATTAGGGACAGCAG 0: 1
1: 0
2: 0
3: 1
4: 118
Right 992365695 5:76086890-76086912 AGCAGTAGTATTTGCACTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992365695 Original CRISPR AGCAGTAGTATTTGCACTTG AGG Intronic
900958328 1:5902293-5902315 AGCAGCAGGCTTTGCACCTGGGG - Intronic
905502025 1:38447011-38447033 AGCAGTACTCTTGGCATTTGGGG + Intergenic
905712673 1:40119804-40119826 AGCAGTAGTATTGCTCCTTGAGG + Intergenic
906933499 1:50191752-50191774 AGGAGTAGGATTTGGACTTGAGG + Intronic
913550264 1:119910495-119910517 AGCAGAGCTATTTCCACTTGTGG - Intergenic
915628755 1:157135769-157135791 AGCAGTGGAATGTGCAGTTGGGG - Intronic
916352134 1:163862761-163862783 AGCAAAAGTCTTTGCTCTTGTGG - Intergenic
917621868 1:176804477-176804499 GGCAGTATTATTGGCATTTGGGG - Intronic
922075633 1:222241148-222241170 AGCAATAGTATCTCCAGTTGAGG - Intergenic
923782393 1:237036715-237036737 TGCAGTAGTTATTGCATTTGAGG + Intergenic
1062926367 10:1318458-1318480 AGCAGTACCATTTGCACTCCTGG + Intronic
1063894694 10:10667606-10667628 AGCAGTATTATTCCCACTTTTGG + Intergenic
1070274209 10:74989265-74989287 AGCAGTACATTTTTCACTTGAGG - Intronic
1073554977 10:104440779-104440801 AGCAGTAATATTTGTATTTGTGG - Intronic
1073915241 10:108396036-108396058 ACCAGTAATTTTTGCACGTGAGG + Intergenic
1074809939 10:117093845-117093867 AGCATTGGTTTTTGAACTTGGGG - Intronic
1075884974 10:125892013-125892035 AGTAGTAGTAGTTGGACATGTGG - Intronic
1076227032 10:128786130-128786152 AGCAGTAGTATTTTCAAGGGGGG - Intergenic
1079640799 11:22802629-22802651 AGCAGTAGTTTTTGCATGTTAGG - Intronic
1079724704 11:23866839-23866861 AGCAGAGGCATTTGCACTTTAGG - Intergenic
1079782118 11:24620458-24620480 AGTGGTAATATTTGCACCTGAGG + Intronic
1083836992 11:65276684-65276706 AGCAGTAGTATTAACCCTTCAGG + Intronic
1086236212 11:84634057-84634079 AGCTGCTCTATTTGCACTTGAGG + Intronic
1086253793 11:84849550-84849572 TGCCATAGTCTTTGCACTTGTGG + Intronic
1092003060 12:5047027-5047049 AGCAGTAGTATCAGCCCTTATGG + Intergenic
1092811239 12:12273166-12273188 AGCAGGAGGATTTCCACTTCTGG + Intergenic
1098553134 12:71786801-71786823 AGCAGTAGCATTTGCCTTTTGGG + Exonic
1100809659 12:98325437-98325459 GGCAGTGGAATTTGCCCTTGGGG + Intergenic
1102006437 12:109591982-109592004 ACCTGTAGTATTAGCACTTTGGG + Intronic
1102417029 12:112772664-112772686 AGTAGTAGTATTGTCATTTGGGG + Intronic
1111224044 13:85245848-85245870 TGCAGTAGCAGTTGCAATTGGGG - Intergenic
1118079263 14:62339504-62339526 AGCAGCAGTAGTTGCACCAGAGG + Intergenic
1118477921 14:66135622-66135644 AGAAGTAGGATTTCCACTTCAGG - Intergenic
1128164921 15:65455465-65455487 AGCAGAAGGAATTGCTCTTGAGG + Intronic
1130983563 15:88829533-88829555 CGCAGTAGCATATGCACTCGAGG - Intronic
1131026870 15:89150452-89150474 TGCAGTGATATTTGCACCTGTGG + Intronic
1131429245 15:92373249-92373271 AGCAGTCTTATTTTCTCTTGAGG + Intergenic
1131887215 15:96929162-96929184 AGCAGTAGTCTTTTTACTGGAGG + Intergenic
1135668390 16:24354653-24354675 AGAAGGAGTCTTGGCACTTGGGG - Intronic
1136096800 16:27962794-27962816 AGCTGTAGGATTTGACCTTGGGG - Intronic
1138134647 16:54511193-54511215 AACAGTAGTATTTGGATTTATGG + Intergenic
1140068569 16:71629463-71629485 TGCACAAGTATTTGCATTTGTGG - Exonic
1143234347 17:5385680-5385702 AGCAGTGGCCTTTGCAATTGTGG + Exonic
1153520304 18:5946229-5946251 ATAAGTAATATTTGCACCTGTGG - Intergenic
1157892275 18:51428991-51429013 AGCAGTTGTATTTACAAGTGAGG - Intergenic
1158165880 18:54539575-54539597 AGCAGAAGTTGCTGCACTTGTGG - Intergenic
1158298980 18:56031424-56031446 ACCAGGAGTATTTGCAATGGGGG - Intergenic
1158332306 18:56375992-56376014 AGCAGAAGAATTTGTCCTTGAGG - Intergenic
1158632513 18:59128203-59128225 AGCAGGAGCATTTCCCCTTGGGG + Intergenic
1159175255 18:64825349-64825371 TGCAACAGTATTTGCACTTAGGG - Intergenic
1165165248 19:33849469-33849491 AGCAGTGGAATTTGTCCTTGGGG - Intergenic
926492638 2:13543720-13543742 AGCAGTAGTAGTGTCACTTTAGG - Intergenic
931755133 2:65367012-65367034 AGGTGAAGAATTTGCACTTGTGG - Intronic
931923398 2:67044954-67044976 AGCAGCACTCTCTGCACTTGAGG + Intergenic
938867541 2:135438627-135438649 AGGAGTAGGATTGGGACTTGAGG - Intronic
939421927 2:141982477-141982499 GGCAGTGGTATTTGCACTGTAGG - Intronic
940598281 2:155822361-155822383 TGCAGAAGCATTTTCACTTGAGG - Intergenic
941515037 2:166463170-166463192 ATAAGCAGTATTTGCACATGGGG + Intronic
942070826 2:172313836-172313858 GGCAGAAGGCTTTGCACTTGTGG - Intergenic
944993881 2:205271574-205271596 AGCAGAAATATTTGCTCTTTTGG + Intronic
945541670 2:211095383-211095405 AGCTGTAGTATTTCCTCTAGCGG - Intergenic
1168756631 20:323043-323065 AGCTGTAGTCTTAGCACTTTGGG - Intergenic
1169913821 20:10668451-10668473 TGCAGGAGTATTTGCATTTATGG + Intronic
1170938006 20:20826301-20826323 AGGAGTCGTATTTGAACATGGGG - Intergenic
1172020513 20:31910544-31910566 ATCAGTAGTATTTGAACAAGGGG - Intronic
1177664026 21:24128811-24128833 AACAGAAGTATTTGGACTTCTGG - Intergenic
1178288510 21:31346177-31346199 AGCAGCACTATTGGCATTTGTGG - Intronic
1179352641 21:40627366-40627388 AGGAGTTGGATTTGCCCTTGTGG - Intronic
1180285031 22:10737583-10737605 AGTAGTAGTAGTTGGACATGTGG - Intergenic
1183045025 22:35212661-35212683 AGAAGTAGTATTTGCCTTGGGGG - Intergenic
950923710 3:16719420-16719442 AGCAGGAGTATATGCAACTGTGG - Intergenic
952146903 3:30542976-30542998 AACAGTTGTATTTGAATTTGAGG + Intergenic
952831605 3:37569690-37569712 AGGTGTAGAATTTCCACTTGTGG - Intronic
958025926 3:88049165-88049187 AAAAGTAGAATTTGCACTTTGGG + Intergenic
959736393 3:109664455-109664477 AGCAGGAGTACCTGGACTTGGGG + Intergenic
960268698 3:115650640-115650662 AGCACTAGAATCTGCACATGTGG + Intronic
960845928 3:122004737-122004759 AGCACTAGGATTCTCACTTGGGG + Intronic
963687655 3:148457665-148457687 AACTGTATTATTTCCACTTGTGG + Intergenic
966401077 3:179547265-179547287 TGCAGTTGTATATGCATTTGGGG - Intergenic
967486347 3:190035864-190035886 AGCAGTAATATTTGGAGTGGGGG + Intronic
969115245 4:4867178-4867200 AGCGGTAGGATTCGCACTCGGGG - Intergenic
969962847 4:10963070-10963092 AACAGTAATATTTCCACTTGTGG - Intergenic
972905028 4:43735530-43735552 AGCAGTAGCTTTTTAACTTGAGG - Intergenic
974088791 4:57288914-57288936 ATCAGCAATATTTGCAGTTGTGG + Intergenic
974292418 4:59949068-59949090 TGCAGTAGTATCTGCATTAGGGG - Intergenic
974728039 4:65822101-65822123 AGCAGTAGTAGTAGTACTAGTGG + Intergenic
975217140 4:71768924-71768946 AGCAGTAGAAATTGAACTTAGGG + Intronic
976032983 4:80780133-80780155 AGAAGTAGGATTTGCAGATGTGG - Intronic
977237891 4:94530760-94530782 AGCAGCAGTATTTGGACCTCTGG - Intronic
977546624 4:98389655-98389677 AGCAGTAATATTTGAAATTATGG - Intronic
978505457 4:109451451-109451473 ATCAATAGTATTGGCACTTTGGG - Intronic
980686014 4:136229377-136229399 AGCCCTAGTACTTACACTTGAGG + Intergenic
981495873 4:145391616-145391638 AGTAGTAGGCTTAGCACTTGGGG + Intergenic
982753410 4:159190345-159190367 AGCAGAAGTCTCTGTACTTGTGG + Intronic
987805698 5:22763522-22763544 AGCAATGGTCTTTGCACATGAGG + Intronic
988798671 5:34675958-34675980 AGAAGTAGCATTTGTAATTGTGG - Intronic
991649365 5:68836419-68836441 AGCACTAGAGTTTGCAGTTGTGG + Intergenic
991980726 5:72227799-72227821 AGCAGAAGTAGTAGCACTTCAGG - Intronic
992365695 5:76086890-76086912 AGCAGTAGTATTTGCACTTGAGG + Intronic
993769066 5:91901931-91901953 GGCAGTAGGATTTGTACTTTTGG + Intergenic
997644077 5:135468655-135468677 AGCACAAGTATCTGGACTTGGGG + Intergenic
998181608 5:139949914-139949936 AGCAGTACTAGTTGCCCTTTGGG - Intronic
998995237 5:147864336-147864358 AGCAGGAGTATCTGCTCATGGGG - Intergenic
1000412987 5:160953529-160953551 AGCTGTGGTATTTGCATTTGGGG - Intergenic
1001629165 5:173161724-173161746 TGCAGGAGTAGTTGCAGTTGGGG + Intronic
1004142713 6:13034796-13034818 AACAATTGTATTTGCATTTGAGG + Intronic
1004557563 6:16714237-16714259 AGCAGTAGTACATGCAAATGGGG - Intronic
1008194779 6:48505324-48505346 AGCAGAAGAAATGGCACTTGAGG + Intergenic
1012190670 6:96276357-96276379 AGAAGTAATATGTGCATTTGAGG + Intergenic
1016812112 6:148271213-148271235 AGCAGTGGTATTAGGAGTTGTGG - Intergenic
1017401847 6:154073653-154073675 AACAGAAGAATTTACACTTGAGG + Intronic
1019992181 7:4699869-4699891 AGAAGTATTATCTGCACATGAGG - Intronic
1020604742 7:10322743-10322765 AGAAATAGTATTTGTACCTGGGG + Intergenic
1021774157 7:24035547-24035569 GGCAGTAGCATTTGCATTTTTGG + Intergenic
1025965033 7:66261929-66261951 AGCAGTAATATATGCAGTGGTGG - Intronic
1030758684 7:113322622-113322644 AGCACTAGCATTTGTTCTTGTGG + Intergenic
1031092721 7:117379572-117379594 AGTAGTAATATTTTCACTTAGGG - Intronic
1047879136 8:129173163-129173185 AACAGTGGTATTTGGAATTGGGG + Intergenic
1048724371 8:137365589-137365611 AGCAGAAGTCTATGAACTTGAGG + Intergenic
1050468296 9:5956571-5956593 AGCAGTAGTATAAGCTTTTGGGG - Intronic
1051528417 9:18073491-18073513 CACAGTGGTGTTTGCACTTGGGG + Intergenic
1055854573 9:80670212-80670234 AGCAGTGGGATTTGTACTTACGG + Intergenic
1058635887 9:107038278-107038300 AGCAGTAATATTTGTGCATGTGG - Intergenic
1203731393 Un_GL000216v2:94604-94626 AGTAGTAGTAGTTGGACATGTGG - Intergenic
1185582523 X:1221910-1221932 AAAAGGAGTATTTGCTCTTGGGG + Intergenic
1185824021 X:3231854-3231876 AGCAGTCGTTTTTGCAACTGAGG - Intergenic
1186579205 X:10799160-10799182 ACCAGTAATATTAGCACTGGTGG - Intronic
1188947412 X:36323591-36323613 AGCAGTAGCATTCATACTTGAGG - Intronic
1191839526 X:65501808-65501830 GATGGTAGTATTTGCACTTGTGG - Exonic
1192801330 X:74467300-74467322 AGCAGTAGGGTTTGGAGTTGGGG + Intronic
1193613493 X:83659972-83659994 AGTAGCAGTATTTATACTTGGGG + Intergenic
1194681317 X:96857049-96857071 AAAAGTGGTGTTTGCACTTGAGG + Intronic
1194969678 X:100329449-100329471 AGCAAAAGAATTTGCACTTTAGG + Intronic
1196129906 X:112144321-112144343 AGCAGTGGTTCTTCCACTTGAGG + Intergenic
1198640243 X:138748246-138748268 AGCTTTAGTATATGCATTTGGGG - Intronic
1200763958 Y:7064673-7064695 AGCAGTAGTATGTCCAAGTGGGG - Intronic