ID: 992365697

View in Genome Browser
Species Human (GRCh38)
Location 5:76086910-76086932
Sequence AGGATGGCTTACCTATTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992365693_992365697 13 Left 992365693 5:76086874-76086896 CCTCCTAATTAGGGACAGCAGTA 0: 1
1: 0
2: 0
3: 3
4: 66
Right 992365697 5:76086910-76086932 AGGATGGCTTACCTATTGAGAGG 0: 1
1: 0
2: 1
3: 2
4: 65
992365692_992365697 14 Left 992365692 5:76086873-76086895 CCCTCCTAATTAGGGACAGCAGT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 992365697 5:76086910-76086932 AGGATGGCTTACCTATTGAGAGG 0: 1
1: 0
2: 1
3: 2
4: 65
992365694_992365697 10 Left 992365694 5:76086877-76086899 CCTAATTAGGGACAGCAGTAGTA 0: 1
1: 0
2: 1
3: 3
4: 76
Right 992365697 5:76086910-76086932 AGGATGGCTTACCTATTGAGAGG 0: 1
1: 0
2: 1
3: 2
4: 65
992365691_992365697 15 Left 992365691 5:76086872-76086894 CCCCTCCTAATTAGGGACAGCAG 0: 1
1: 0
2: 0
3: 1
4: 118
Right 992365697 5:76086910-76086932 AGGATGGCTTACCTATTGAGAGG 0: 1
1: 0
2: 1
3: 2
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992365697 Original CRISPR AGGATGGCTTACCTATTGAG AGG Intronic
900299509 1:1969803-1969825 AGGATGCCTTGCCCAGTGAGAGG + Intronic
919165243 1:193884636-193884658 AGGATGGCTTGCCTACAGAGAGG - Intergenic
920183868 1:204148806-204148828 AGGAGGGCTTGCATACTGAGGGG - Intronic
1065784633 10:29201959-29201981 AGGATGGCTGACCTCTGCAGAGG - Intergenic
1066179959 10:32951649-32951671 ATAATGTCTTACCTTTTGAGTGG - Intronic
1071452466 10:85810347-85810369 AGGATGGCTTACCTGCAGTGTGG - Intronic
1077061406 11:619294-619316 AGGGGGGCTTACCTGTGGAGGGG + Exonic
1077818605 11:5713322-5713344 AGTATGAACTACCTATTGAGAGG - Intronic
1081399574 11:42627077-42627099 AGGATGGCTTAACTACATAGAGG - Intergenic
1088792597 11:113239127-113239149 AGCATGGCTTACCTGTTTGGAGG + Intronic
1098716789 12:73838095-73838117 ATTTTGGCTTACCTATTGACAGG + Intergenic
1099391043 12:82078685-82078707 AGGAGGGACTTCCTATTGAGGGG - Intergenic
1111761504 13:92471469-92471491 TGGATGGCTTACCTATAAATAGG - Intronic
1121061404 14:90913468-90913490 AGGAAGCCTTAGCCATTGAGAGG - Intronic
1126990809 15:54373936-54373958 AGGATGGCCTGCCTATGGATAGG - Intronic
1134287954 16:12879032-12879054 AGGAAGTCTTACCCATAGAGAGG - Intergenic
1142528255 17:560414-560436 AGGATGGCTCACCTGCTGGGTGG + Exonic
1156870951 18:41944498-41944520 AGGATGCCTTACCTATGGAGTGG + Intergenic
1157742385 18:50105066-50105088 AGAATGGTTTCCCTATTGACTGG + Intronic
1166386956 19:42387624-42387646 AGGATGGCTTAGCGATTGGAAGG + Intronic
928428599 2:31199706-31199728 AGAATGGCTCACTTAATGAGAGG - Intronic
928579953 2:32697334-32697356 ATGGTGTCTTACATATTGAGAGG - Intronic
930946602 2:57084006-57084028 AGGATGACCTGCCTATGGAGAGG - Intergenic
932629314 2:73324761-73324783 AGGATGTCTTGCCACTTGAGTGG + Intergenic
938222035 2:129577845-129577867 AGGATAGCTCACCTATGGAAGGG - Intergenic
946789334 2:223284848-223284870 AGAATGTCTTGCCTATGGAGAGG - Intergenic
1176205813 20:63887579-63887601 TGGCTGGCATACTTATTGAGTGG - Exonic
1179533070 21:42033187-42033209 AGGAAGCCTGACCTTTTGAGGGG + Intergenic
1180716449 22:17875838-17875860 AGGCTGCCTTACCCATTCAGAGG - Intronic
1183043824 22:35203712-35203734 AGGATGACATAACTATTCAGAGG - Intergenic
951739281 3:25902225-25902247 AGGAAGGCAGACCTATAGAGTGG + Intergenic
955923457 3:63982309-63982331 AGGTTGGCTTTGGTATTGAGGGG - Exonic
957634607 3:82764025-82764047 AGAAAGGCTTCCCTATTCAGTGG - Intergenic
974102709 4:57435691-57435713 AAGATGGCTTATATATTGATAGG + Intergenic
974360638 4:60873920-60873942 ATGCTGGTTTACCTTTTGAGGGG - Intergenic
974771233 4:66416584-66416606 AGGATGGATTATCTAATGATGGG + Intergenic
980595613 4:134950541-134950563 AGGATTGCAGACCAATTGAGTGG - Intergenic
982387437 4:154825842-154825864 AGGCTGCATTACCTCTTGAGTGG + Intronic
991359244 5:65802807-65802829 AGGATGACCTACCTGTGGAGAGG - Intronic
992365697 5:76086910-76086932 AGGATGGCTTACCTATTGAGAGG + Intronic
993469296 5:88287274-88287296 AGGAAGGCTTACCTTTTGCAGGG - Intergenic
993499343 5:88647407-88647429 AGACTGGCTAACTTATTGAGTGG + Intergenic
1005166737 6:22931406-22931428 AGGATAGCTTAGCTATTTTGGGG + Intergenic
1006505845 6:34488119-34488141 TGGGTGGCTTCCCTTTTGAGGGG + Intronic
1008261402 6:49370124-49370146 AGGATGGCTTCCCTGTCCAGGGG - Intergenic
1008471892 6:51893787-51893809 AATATGCATTACCTATTGAGTGG + Intronic
1014219188 6:118782845-118782867 AGGATGGCTTACATCTTAAATGG + Intergenic
1016081344 6:139861395-139861417 AAGATGGCTGACATATTTAGTGG + Intergenic
1029986306 7:104926441-104926463 AGAATGGCTTACCTAATGTAGGG + Intergenic
1030610229 7:111680829-111680851 AGTAAGGCTTACCTATTCAAAGG - Intergenic
1031242028 7:119257993-119258015 GGGATGACTTGCCTATAGAGAGG - Intergenic
1034545553 7:151786458-151786480 AGGAGGTCTTACCTTTCGAGAGG + Exonic
1037057112 8:14456585-14456607 GAGATTGGTTACCTATTGAGGGG + Intronic
1037763974 8:21760427-21760449 AGGATTGCTTGCATTTTGAGTGG + Intronic
1038130664 8:24727545-24727567 AGGCTGTCTTGCCTATTAAGGGG - Intergenic
1040098545 8:43474956-43474978 GAGATTGATTACCTATTGAGGGG + Intergenic
1041145795 8:54875038-54875060 AGAATGGAAAACCTATTGAGAGG + Intergenic
1042439639 8:68810723-68810745 AGGATGACCTGCCTATAGAGAGG - Intronic
1046775406 8:118158793-118158815 GGGATGACTTACCTGTGGAGAGG + Intergenic
1050059129 9:1687283-1687305 AGGATGGCTTAAGTATTTAATGG + Intergenic
1051245073 9:15101761-15101783 AGAATGGCATACCATTTGAGAGG + Intergenic
1055943312 9:81670837-81670859 AGTATGGCTTACCTACCGAAAGG - Intronic
1060015651 9:120084207-120084229 AGGATGGCTTCCTTCTTGAGAGG - Intergenic
1062329151 9:136029248-136029270 AGGATGGCCTACCTGAGGAGGGG + Intronic
1186950146 X:14615491-14615513 AAGATGCCTAACCTATTAAGTGG + Intronic
1188691995 X:33140758-33140780 AGGATAGCTTACTTATACAGGGG - Intronic
1193721209 X:84989954-84989976 AGGATGGCATATCTACAGAGGGG - Intergenic
1194885270 X:99307574-99307596 AGGAAGGCTGAGCTAATGAGAGG + Intergenic
1195653584 X:107312906-107312928 AAAATGGCCTACCTAGTGAGAGG - Intergenic