ID: 992367340

View in Genome Browser
Species Human (GRCh38)
Location 5:76106147-76106169
Sequence CTATCAACTCAGATGGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992367340_992367349 25 Left 992367340 5:76106147-76106169 CCCTACCCCATCTGAGTTGATAG 0: 1
1: 0
2: 1
3: 13
4: 115
Right 992367349 5:76106195-76106217 TTCCTCTTGTGTACCGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992367340 Original CRISPR CTATCAACTCAGATGGGGTA GGG (reversed) Intronic
901937859 1:12639345-12639367 CTATCAACTCGACTGGGTTAAGG + Intergenic
904831387 1:33308125-33308147 CTTTCAACTTAGATGGGGCAGGG + Intronic
905537303 1:38732513-38732535 CCATCAATTCAGCTGGGGGAGGG + Intergenic
908894503 1:68883167-68883189 CTGTTAACTGAGATGGGGAATGG + Intergenic
910361251 1:86415373-86415395 CTCACAACTCAGTTGGGGTATGG + Intergenic
910464657 1:87485323-87485345 CTGTCACCTCAGAAGGGGTTTGG + Intergenic
912573910 1:110646577-110646599 GTAACAACTCAGATGGGAGATGG + Intergenic
914359431 1:146920035-146920057 CTGTCACCTCAGAAGGGGTTTGG + Intergenic
914389526 1:147207267-147207289 CTATCTACAGAGATGGGGAAAGG + Intronic
914494318 1:148179840-148179862 CTGTCACCTCAGAAGGGGTTTGG - Intergenic
922135483 1:222821209-222821231 CAATTAATTCAGATGGGGTTGGG + Intergenic
923079991 1:230644074-230644096 CTGTCAACTCAGAGTGGGAAAGG - Intronic
923759836 1:236831843-236831865 CTATCTGCTCAGATGGGCTATGG + Intronic
924948656 1:248863342-248863364 CTATCAACTCAGGAGGGGGCGGG - Intergenic
1068002757 10:51355622-51355644 CTAACAACTGAGAAGAGGTAGGG - Intronic
1069503721 10:68977672-68977694 TGATCAACTCAAATGTGGTAAGG + Exonic
1070414676 10:76178581-76178603 CTCTGAACTCAGTTGGGGTGAGG + Intronic
1072051220 10:91705474-91705496 CTGTCAACCCAGATGGAGTAGGG - Intergenic
1072158580 10:92745952-92745974 CTATCAGATCAAATGGGGCAAGG + Intergenic
1076655342 10:132019891-132019913 GGATCAACTCAGAAGGGGCAGGG + Intergenic
1078820697 11:14878129-14878151 CTTTCAGCACAGATGAGGTAGGG + Exonic
1080155313 11:29104069-29104091 CCATTAACTTAGATGGGGAAGGG - Intergenic
1085120459 11:73964323-73964345 CTGTCAGCTGAGATGGGGGAGGG - Intronic
1085617644 11:78013590-78013612 TAATAAACTCAGATGGGGAAGGG - Intergenic
1087617087 11:100499292-100499314 TTATCAACTCAGATGGGGGAAGG + Intergenic
1088050645 11:105510335-105510357 CTATTAAATCAGATGGGGTCAGG + Intergenic
1088600667 11:111471843-111471865 CTATCAGTTGAGATGGGGGAAGG - Intronic
1089166512 11:116481617-116481639 CTATGAAAGCAGATGGCGTAAGG - Intergenic
1089505888 11:118961594-118961616 CTGCCAACTCAGAAGGGGCAGGG + Intergenic
1092447203 12:8568372-8568394 CTACCAACTCAGAAGGGGTGGGG + Intergenic
1093296239 12:17395537-17395559 CTATAAACTATGATGGGGCAGGG + Intergenic
1093355104 12:18157388-18157410 CTATCTACTAAGATGTGTTATGG - Intronic
1097130130 12:56805400-56805422 CTAACAAATCAGAAGGGGCAGGG + Intergenic
1100875318 12:98955737-98955759 CCATCAAGTGAGATGGGGGAAGG + Intronic
1111188568 13:84777391-84777413 CACTCAAGTCACATGGGGTAAGG - Intergenic
1111654802 13:91139218-91139240 CTATCCATTCAGATGGAGCAGGG + Intergenic
1116541695 14:46108515-46108537 CTGCCAACTCAGAAGGGGTCAGG + Intergenic
1121065504 14:90960252-90960274 CTATCAACTCTGTTAGGATAGGG + Intronic
1122246946 14:100410088-100410110 CTGGAAACTCAGATGGGGTTTGG - Intronic
1123796733 15:23780195-23780217 CTTTAAAATCTGATGGGGTAAGG + Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1125547472 15:40517091-40517113 CTAGCTACTCAGAAGGGGCAGGG - Intergenic
1128673038 15:69588587-69588609 CTATCAACTGGGATTGGGTTTGG - Intergenic
1130444513 15:83987846-83987868 CTATGAAGTGAGATGGGGCAGGG + Intronic
1132305210 15:100807276-100807298 CCATCAACTCAGAAGGGGCAGGG - Intergenic
1132978895 16:2724871-2724893 CTGCCAACTCAGAAGGGGCAGGG - Intergenic
1137238357 16:46633697-46633719 CCAACAACTCAGAAGGGGTGGGG + Intergenic
1139303934 16:65967538-65967560 GGATCAACTCAGAAGGGGTCAGG + Intergenic
1143991442 17:10966742-10966764 CTATGAAGTCAGATAGGGAATGG + Intergenic
1144440486 17:15276867-15276889 CCCTCAACTGAGATGGGGTGGGG + Intergenic
1149085368 17:52709977-52709999 CCACCAACTCAGAAGGGGTGGGG - Intergenic
1149160523 17:53687267-53687289 CCACCAACTCAGAAGGGGCAGGG + Intergenic
1151181090 17:72329193-72329215 CTATTATGTCAGATGGGATAAGG - Intergenic
1153624813 18:7013674-7013696 CTTTGAACTCAGATGCGGAAGGG + Intronic
1153937400 18:9941303-9941325 CTAACAACCCAGATGGAGTTGGG - Intronic
1165022496 19:32935987-32936009 CCACCAACTCAGAAGGGGCAGGG - Intronic
1167779588 19:51590523-51590545 CTATCAACCTTGAAGGGGTATGG - Exonic
925048060 2:789624-789646 CCATCAACTCAGAGGGGTCAGGG - Intergenic
932599566 2:73113932-73113954 ATGTCAGCTCAGATGGGGGAGGG + Intronic
934699740 2:96430062-96430084 GCTTCAACTCAGAAGGGGTAGGG - Intergenic
934908693 2:98229909-98229931 ATATTAACCCAGATGGGGGAAGG + Intronic
936290223 2:111217212-111217234 CTGCCAACTCAGAAGGGGTGGGG + Intergenic
937610196 2:123851967-123851989 CTGGGAACTCAGATGGGGAAAGG + Intergenic
942396175 2:175551989-175552011 CTAGCAAAGCAGATGGGGGAGGG + Intergenic
946654099 2:221926577-221926599 CTGCCAAGTTAGATGGGGTAGGG + Intergenic
1173585053 20:44176007-44176029 CCATGAACTGAGATGGGGTGAGG - Intronic
1175064300 20:56272357-56272379 CCACCAACTCAGAAGGGGCAGGG - Intergenic
1177736096 21:25092431-25092453 CCATCAACTGAGAAGGGGCAGGG + Intergenic
1182381622 22:29894568-29894590 GTGGCAACTCAGATGGGATATGG + Intronic
1182502763 22:30759425-30759447 CTATCAAATAAGTTGGGTTAAGG - Intronic
1184173750 22:42774507-42774529 CTTGCAACTCAGAAGGGGCAGGG - Intergenic
951359208 3:21704449-21704471 CTATGAAATAACATGGGGTAGGG - Intronic
952269471 3:31817450-31817472 CCATCAACTCAGAAGGGGCAGGG + Intronic
952666978 3:35918934-35918956 CTATGAATTCATATGGTGTAGGG + Intergenic
954703753 3:52467365-52467387 CCTTCAGCACAGATGGGGTAGGG + Intronic
956814470 3:72895217-72895239 AGAGCAACCCAGATGGGGTAGGG + Intronic
965541988 3:169880047-169880069 CTGCCAACTCAGAAGGGGTGGGG - Intergenic
968951096 4:3692290-3692312 TTATAACCTCAGATTGGGTAAGG - Intergenic
968970585 4:3791550-3791572 TCAGCAACTCAGGTGGGGTAAGG - Intergenic
969986576 4:11217619-11217641 CCAACAACTCAGAAGGGGAAGGG - Intergenic
972646865 4:40976746-40976768 CTATTTATTCAGATGGGGCAAGG + Intronic
976430634 4:84960104-84960126 ATTTCAACTGAGATTGGGTAGGG + Intronic
977825931 4:101531600-101531622 AAATCAACTCAGATGGATTAAGG - Intronic
980054859 4:128069489-128069511 TTATCAAGCCAGATGGGGTGGGG + Intronic
980323238 4:131306371-131306393 AAATCAACTTAGATGGGCTAAGG + Intergenic
982288181 4:153756414-153756436 CTATTAACTGAGATGGGGGATGG - Intronic
987288452 5:16484504-16484526 CTATCATCTGAGCTGTGGTAGGG + Intronic
991140163 5:63231524-63231546 TTATCAACTCAGATGGGCTTTGG - Intergenic
991353872 5:65747851-65747873 CACTCAGCTCAGATGAGGTAAGG - Intronic
992367340 5:76106147-76106169 CTATCAACTCAGATGGGGTAGGG - Intronic
993127944 5:83858626-83858648 CTATAAAACCAGGTGGGGTAAGG - Intergenic
994981138 5:106876083-106876105 CCTACAACTCAGTTGGGGTATGG + Intergenic
999799588 5:155020173-155020195 GTCTCAACTCAGAAGGGGCAGGG + Intergenic
1001123180 5:168996742-168996764 CTATCACCTCACATGGGGATTGG - Intronic
1001360560 5:171081108-171081130 CTTTAAACTCAGATGGACTAGGG - Intronic
1005781780 6:29200903-29200925 CTGTCAACTCATAAGGGGTTGGG - Intergenic
1008959477 6:57251569-57251591 CTATTAACTGACATGGGGGAAGG + Intergenic
1009498422 6:64380020-64380042 CTATCAACTCAAATTGTGTCTGG + Intronic
1009931336 6:70180221-70180243 CTATAAACTCAATTGGGGTTGGG + Intronic
1010384321 6:75261885-75261907 TTATCAATACAGATGGTGTAGGG - Intronic
1011192664 6:84749120-84749142 CTTTCAAGGCTGATGGGGTAGGG + Intronic
1012889815 6:104885516-104885538 CCACCAACTCGGAAGGGGTAGGG - Intergenic
1016899901 6:149091077-149091099 CTATCAAGACAGATGGAGTAAGG + Intergenic
1017337152 6:153274818-153274840 CTATCATCTCTGAGAGGGTAGGG - Intergenic
1018065068 6:160118885-160118907 CTGCCAACTCAGAAGGGGTGGGG + Intergenic
1021526652 7:21595575-21595597 CAATCTATTCAGATGGGGAAGGG + Intronic
1021561561 7:21972689-21972711 CTCCCAACTCAGAAGGGGCAGGG + Intergenic
1024864946 7:53895217-53895239 CCATCAACTCAGAGGGAGTATGG - Intergenic
1026359709 7:69591849-69591871 CTGCCAACTCAGAAGGGGCAGGG + Intergenic
1032919371 7:136527970-136527992 CTTTCAACTCAGAAGGGGGCTGG + Intergenic
1033471513 7:141653756-141653778 ATATCAACTTAGATGGGTGAGGG - Exonic
1042651895 8:71052318-71052340 CCTTCAACTGAGTTGGGGTAAGG + Intergenic
1044308018 8:90659845-90659867 CATTCAACTCAGATGGGGAATGG - Intronic
1051310467 9:15765606-15765628 CTATCAATTGAGATGGAGGAAGG + Intronic
1051745043 9:20287430-20287452 CTATCAACTCCCCTGGGGTGAGG + Intergenic
1052393811 9:27913285-27913307 CTATGTACTCACATGGGGAATGG - Intergenic
1053729761 9:41041598-41041620 CCATGAACTGAGATGGGGAAGGG - Intergenic
1056295882 9:85192677-85192699 CTATCCATGAAGATGGGGTAGGG - Intergenic
1058418847 9:104816374-104816396 CAATCAACTCAGAGGGGCTTCGG + Intronic
1060080350 9:120638106-120638128 CTAGCAACTCAGAGGGGCTGAGG - Intronic
1185866054 X:3624971-3624993 CACTCAACTCAGATGGGATTTGG + Intronic
1187690437 X:21860734-21860756 CTAGCAACTGAGCTGGGGTTGGG + Intronic
1196894689 X:120323320-120323342 CTGTCAACTCGAATGGGCTAAGG - Intergenic
1198233104 X:134712263-134712285 CTGGGAAGTCAGATGGGGTATGG - Intronic
1198708131 X:139471822-139471844 CTATTAACTCTGGTGGTGTAAGG + Intergenic
1200797770 Y:7357356-7357378 CACTCAACTCAGATGGGATTTGG - Intergenic
1200919232 Y:8598430-8598452 CAATAAAGTCAGATGGGGTGAGG + Intergenic
1200926131 Y:8656609-8656631 CAATAAGGTCAGATGGGGTAAGG + Intergenic
1201241902 Y:11965481-11965503 CCATAAATACAGATGGGGTATGG + Intergenic
1201500870 Y:14641196-14641218 ATATCAACTTAGATGGGTAAGGG - Intronic