ID: 992368147

View in Genome Browser
Species Human (GRCh38)
Location 5:76114250-76114272
Sequence TGGCATTATTCCCATGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 203}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992368147_992368156 11 Left 992368147 5:76114250-76114272 CCATCACCATGGGAATAATGCCA 0: 1
1: 0
2: 1
3: 14
4: 203
Right 992368156 5:76114284-76114306 TTTATCATGGTGTTCAGGAAGGG 0: 1
1: 0
2: 2
3: 18
4: 239
992368147_992368154 6 Left 992368147 5:76114250-76114272 CCATCACCATGGGAATAATGCCA 0: 1
1: 0
2: 1
3: 14
4: 203
Right 992368154 5:76114279-76114301 TGGATTTTATCATGGTGTTCAGG 0: 1
1: 0
2: 0
3: 38
4: 765
992368147_992368158 29 Left 992368147 5:76114250-76114272 CCATCACCATGGGAATAATGCCA 0: 1
1: 0
2: 1
3: 14
4: 203
Right 992368158 5:76114302-76114324 AAGGGCTGAATAAACAAAGGCGG No data
992368147_992368155 10 Left 992368147 5:76114250-76114272 CCATCACCATGGGAATAATGCCA 0: 1
1: 0
2: 1
3: 14
4: 203
Right 992368155 5:76114283-76114305 TTTTATCATGGTGTTCAGGAAGG 0: 1
1: 0
2: 5
3: 394
4: 8106
992368147_992368157 26 Left 992368147 5:76114250-76114272 CCATCACCATGGGAATAATGCCA 0: 1
1: 0
2: 1
3: 14
4: 203
Right 992368157 5:76114299-76114321 AGGAAGGGCTGAATAAACAAAGG 0: 1
1: 4
2: 7
3: 46
4: 450
992368147_992368153 -2 Left 992368147 5:76114250-76114272 CCATCACCATGGGAATAATGCCA 0: 1
1: 0
2: 1
3: 14
4: 203
Right 992368153 5:76114271-76114293 CATGGGAGTGGATTTTATCATGG 0: 1
1: 0
2: 1
3: 15
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992368147 Original CRISPR TGGCATTATTCCCATGGTGA TGG (reversed) Intronic
906183740 1:43843845-43843867 TGGCATTATCCACCTGGAGATGG + Intronic
908984691 1:70003203-70003225 AGGCATTAATCCCATCATGAGGG + Intronic
909874377 1:80783898-80783920 TGGCTTTATTTACATTGTGAAGG - Intergenic
911197349 1:95007958-95007980 TGGCACTATTCTAAGGGTGAGGG - Intronic
911349896 1:96740416-96740438 AGGCATTAATCCCATCATGAAGG + Intronic
912027296 1:105193095-105193117 TGGCATTATTTCAATGGACATGG + Intergenic
919252644 1:195078000-195078022 AGGCATTATCCTCATTGTGATGG - Intergenic
920702855 1:208231033-208231055 TGGCATCAGTCCCTTGGTGAAGG + Intronic
920983788 1:210864255-210864277 TGGCATTGCTACCATGCTGAGGG - Intronic
921667619 1:217891532-217891554 TGGAATAATTCCCATTGTGGTGG + Intergenic
924546032 1:245028934-245028956 TGGTATGATTCCCATGGAGTGGG + Intronic
1063620823 10:7646966-7646988 TGCCATTCCTCCCATGGAGATGG - Intronic
1065441963 10:25762197-25762219 GGGCACTAATCCCATGATGAGGG - Intergenic
1065545323 10:26813345-26813367 TGCCATTATCCCCATTATGAAGG - Intronic
1066373096 10:34834001-34834023 TGGAATTATTGCCTGGGTGATGG - Intergenic
1069424450 10:68277658-68277680 AGGCATTTTTCCCATTGTGTTGG - Intergenic
1072032783 10:91537298-91537320 AGGCATTATTTCCATGGTGGAGG + Intergenic
1072742395 10:97917375-97917397 TGGCCTTATGTCCCTGGTGAGGG - Intronic
1077478044 11:2800202-2800224 TGGCTTTATTCCCTTCTTGAAGG - Intronic
1078970449 11:16404361-16404383 TTGCAGAATTCCCGTGGTGAGGG - Intronic
1079501352 11:21104942-21104964 GGGCACTAATCCCATTGTGAAGG + Intronic
1079611358 11:22436355-22436377 GGGCATTAATCCCATCATGAAGG + Intergenic
1079733421 11:23963971-23963993 TTGCATTATTCTCATGATGGTGG - Intergenic
1080076501 11:28156601-28156623 TGGCTTTATTCCCAGGGAGAAGG + Intronic
1080114015 11:28601639-28601661 TGGCATTAATCCCATGATGAGGG + Intergenic
1080586482 11:33687497-33687519 GGGCACTAATCCCATGATGAAGG - Intergenic
1080688410 11:34535006-34535028 AGGCACTAATCCCATCGTGAGGG + Intergenic
1081157725 11:39715927-39715949 TGACATTTTTCCCATGGTCTTGG - Intergenic
1084713238 11:70857244-70857266 TTGCATTATTCCCATTTTGTAGG - Intronic
1087332765 11:96802755-96802777 AGGTATTATTCCCATTTTGATGG + Intergenic
1090476816 11:127030052-127030074 TGACCTTATTCTCTTGGTGAGGG + Intergenic
1090876972 11:130798869-130798891 GGGCACTAATCCCATCGTGAGGG - Intergenic
1092937886 12:13380643-13380665 TGGAGCTATTGCCATGGTGATGG - Intronic
1093196644 12:16137497-16137519 CTGCACTATTCCCATGGTGGGGG - Intergenic
1096934573 12:55257231-55257253 TGGCATTTTAAACATGGTGACGG + Intergenic
1097261555 12:57723406-57723428 CGGCAGCACTCCCATGGTGAAGG + Intergenic
1097553951 12:61114572-61114594 TGTCCTTTTTCACATGGTGAAGG - Intergenic
1097978021 12:65708807-65708829 TGGCATTATTCCCAGGGGTGTGG + Intergenic
1098232516 12:68386873-68386895 AGGCATTAATCCCATCATGAAGG - Intergenic
1098775715 12:74612491-74612513 TAGCATCATTCTCATGGTTAAGG - Intergenic
1100270146 12:93016820-93016842 GGGCACTAATCCCATGATGAAGG - Intergenic
1100408712 12:94293939-94293961 GGGCACTATTCCCATCATGAGGG + Intronic
1101121497 12:101585082-101585104 GGGCATTAATCCCATCATGAGGG - Intronic
1101917970 12:108911024-108911046 AGCCTTTTTTCCCATGGTGAAGG - Exonic
1102800194 12:115725672-115725694 TGGCATTAAACCCATGGGGCTGG + Intergenic
1103185125 12:118950054-118950076 TGGCAATATTCAGATGGAGATGG - Intergenic
1104486708 12:129157228-129157250 TGGCATTAGTCCACTTGTGAGGG + Intronic
1104707923 12:130961621-130961643 TGGCATTTTTCCCATTGAGAAGG - Intronic
1107426122 13:40294787-40294809 TGTCATTCTTCTTATGGTGATGG + Intergenic
1107442718 13:40442588-40442610 TTTCATTCTTCCCATGGTGTGGG - Intergenic
1108227054 13:48300835-48300857 TGGGCTTAATACCATGGTGATGG - Intergenic
1109163654 13:59007175-59007197 TGGCTTTGTTCCCTTGGTGCTGG + Intergenic
1110858593 13:80323685-80323707 TGGCATTAATCCCTTCATGAGGG - Intergenic
1110892663 13:80709320-80709342 TGTCATTATTAGCATGATGAGGG + Intergenic
1111457712 13:88506469-88506491 TGGCAGTTTTCACATGGTGTTGG + Intergenic
1112017015 13:95339810-95339832 TGGCTATATTACCTTGGTGATGG + Intergenic
1112136786 13:96587700-96587722 TGGCATTACTCCCTTAATGAGGG + Intronic
1116397894 14:44469025-44469047 TTTTATTATGCCCATGGTGAGGG + Intergenic
1116861887 14:50001838-50001860 TGGAATTATTCAAATGCTGATGG - Intronic
1118049658 14:62013286-62013308 AGGCATTCTCCTCATGGTGATGG + Intronic
1118067317 14:62206358-62206380 TGGCATTAATCCATTCGTGAGGG + Intergenic
1118115307 14:62769432-62769454 GTGCCTTATTCCCATTGTGAAGG - Intronic
1120970135 14:90200243-90200265 GAGCATTCTTCTCATGGTGATGG + Intergenic
1121097630 14:91228900-91228922 TGGCAGCTTTACCATGGTGAGGG - Intergenic
1122016874 14:98803761-98803783 TGGCATGATCCCCATTTTGAAGG + Intergenic
1122282205 14:100629989-100630011 AGGCTTTATTCACATGGAGACGG - Intergenic
1122422913 14:101588696-101588718 TGGAAGTATTCTAATGGTGAGGG - Intergenic
1123943110 15:25226071-25226093 TGGCATTGTTTCCCTGGGGATGG + Intergenic
1124234566 15:27977760-27977782 AGGCATTAATCCCAGTGTGAGGG - Intronic
1124528471 15:30480369-30480391 TGGCACTAATCCCATGATGGGGG + Intergenic
1124770186 15:32527329-32527351 TGGCACTAATCCCATGATGGGGG - Intergenic
1124912673 15:33937677-33937699 GGCCATTAATCCCATTGTGAAGG - Intronic
1125720046 15:41841040-41841062 TGGCTCTCTTCCCAGGGTGAGGG + Exonic
1129118611 15:73380988-73381010 TGGCATTAATCCATTCGTGAGGG + Intergenic
1131006179 15:88980354-88980376 TGACATTATTCACATGTTGAGGG + Intergenic
1131077912 15:89509755-89509777 TGGCATTAATCCATTCGTGAGGG - Intergenic
1132025248 15:98399590-98399612 GGGCATTATTCCTATCATGAGGG - Intergenic
1132526943 16:421606-421628 GGGCACTGTTCCCATCGTGAGGG - Intergenic
1133656688 16:7871810-7871832 TGGAATTATCCCCAAGTTGAAGG + Intergenic
1135970214 16:27066868-27066890 TGGCTCAGTTCCCATGGTGATGG - Intergenic
1137247119 16:46714770-46714792 TGCCCTCATTCTCATGGTGATGG - Intronic
1138782600 16:59807496-59807518 TGCCACAAATCCCATGGTGAGGG + Intergenic
1140030134 16:71329150-71329172 TGGAAGTGTTCCCATGCTGATGG - Intergenic
1141223619 16:82094409-82094431 TGACATTATTCTCCAGGTGATGG + Intronic
1141535854 16:84679179-84679201 GGGCACTAATCCCATGATGAGGG - Intergenic
1142759116 17:2033160-2033182 TGGCATTTTTCACCTGGTGGGGG + Intronic
1143695300 17:8610615-8610637 TGGCATTAATCCATTGATGAAGG - Intronic
1144010212 17:11140784-11140806 TGGCATTATATCCATGTTGCAGG - Intergenic
1144292919 17:13843718-13843740 TGTCCTTATTCCCAGTGTGACGG + Intergenic
1148700418 17:49583412-49583434 TGGCATTTGTGCCTTGGTGATGG - Intronic
1149246498 17:54714406-54714428 TGGCACTAATCCCATCATGAGGG - Intergenic
1149831701 17:59878247-59878269 TGGCATCATTCTCATGAAGAAGG + Exonic
1150440713 17:65189183-65189205 GGGCATTTTTCTCATGGGGAAGG + Intronic
1153500830 18:5747954-5747976 TGTTATTCTTCCCATGATGATGG - Intergenic
1153650683 18:7237248-7237270 TGGCATTACTGCAATGGTGTGGG + Intergenic
1156070481 18:33201380-33201402 TGGCATCAGTCCATTGGTGAAGG - Intronic
1158394790 18:57071092-57071114 TGGAATTTTGCCCATAGTGAAGG + Intergenic
1159895607 18:73992825-73992847 TCGCATTATGCCCTTAGTGAAGG + Intergenic
1160348760 18:78155899-78155921 TCCCATAATTCCCATGGTGTTGG - Intergenic
1160940870 19:1619904-1619926 TGGCCTGATGCCCATGGGGAGGG + Intronic
1162366997 19:10255712-10255734 TGACTTTATTCCTAGGGTGATGG - Intronic
1164841100 19:31393035-31393057 TGGCATTTGTCCCCAGGTGAGGG + Intergenic
925355970 2:3241483-3241505 TGGCACTAGTTTCATGGTGATGG - Intronic
926034442 2:9624508-9624530 TGGCATTATTGGCATGGGGGGGG + Intronic
927321200 2:21747613-21747635 TGGGATTCTTCACAAGGTGATGG + Intergenic
930547883 2:52792925-52792947 TGCCATGACTCACATGGTGAGGG - Intergenic
933253230 2:80051837-80051859 TGGCATTGCTCCCATGGAAAGGG - Intronic
933309033 2:80637691-80637713 TGGCATTATTCATATGTTGGGGG - Intronic
936171780 2:110183221-110183243 GGCCATGATGCCCATGGTGAAGG + Intronic
939814385 2:146875861-146875883 TGGCAGTAATCCCATCATGAGGG - Intergenic
939929047 2:148209341-148209363 TGGCACTAATCCCATCATGAGGG - Intronic
941644395 2:168024471-168024493 TGGCATTAATCCATTTGTGAGGG - Intronic
945089378 2:206164574-206164596 TGCAATTATTGACATGGTGAAGG + Intergenic
946453585 2:219801907-219801929 TGGCATTAATCCATTTGTGAAGG + Intergenic
948209679 2:236183564-236183586 TAGCACTATCCCCTTGGTGAGGG + Intergenic
1169250188 20:4054654-4054676 TGGCATTAATCCATTCGTGAGGG - Intergenic
1172866339 20:38101824-38101846 GGGCAGTAATCCCATGATGAGGG - Intronic
1173562225 20:44014194-44014216 TAGGATCATTCACATGGTGATGG + Intronic
1173573008 20:44090227-44090249 TGGGCTTGTTCTCATGGTGATGG - Intergenic
1178156772 21:29862938-29862960 TGGCAGTATTCCAATACTGATGG + Intronic
1178269536 21:31177220-31177242 TGGCATTATCCCCATTTTGCAGG + Intronic
1183509862 22:38228356-38228378 TGTCATTATCCCCATGGTACAGG + Intronic
950660783 3:14465690-14465712 TGGTATGATTCCTATGGTTAGGG - Intronic
952990076 3:38824038-38824060 TGACATGGTTCCCATGGGGACGG + Intergenic
954221107 3:49154474-49154496 TGGAATTATCACCATGGGGAAGG - Intergenic
955239607 3:57167114-57167136 TGACATTATTGCCAGGGAGAGGG + Intronic
956184189 3:66546958-66546980 GGGGATTATTCCCAGGGAGAGGG - Intergenic
957986927 3:87584023-87584045 TGGCATTAATCCATTCGTGAGGG + Intergenic
960156382 3:114300833-114300855 TGGCATTAATCCCTTCATGAGGG + Intronic
960217738 3:115063462-115063484 GGGCACTATTCCCATCTTGAGGG + Intronic
962049774 3:131800720-131800742 TGGCCTTAATTCCATGGTGAAGG + Intronic
963018497 3:140848989-140849011 TGGCATAATTCATATGGTGGAGG - Intergenic
963221332 3:142816177-142816199 TGGCATTAATCCATTCGTGAGGG + Intronic
964544674 3:157820832-157820854 TGGCAGTAATCCGATGGAGATGG - Intergenic
964904069 3:161696228-161696250 GGGCATTAATCCCATCATGATGG - Intergenic
965441478 3:168720557-168720579 TGGCATTATTCCATTCATGAAGG + Intergenic
967141053 3:186560717-186560739 AGGCATTATTCCCATGAAGATGG - Intronic
968967175 4:3774869-3774891 AGGCCTTATTCCCATTGTGAAGG - Intergenic
970642606 4:18084144-18084166 TGGCATTGTCCCCATTGTCATGG + Intergenic
971277915 4:25215559-25215581 TGGCAGTTTCCCCATGGTGTTGG - Intronic
972568547 4:40290134-40290156 GGGCATTAATCCCATCATGAGGG - Intergenic
974660402 4:64880933-64880955 TGGCACTAATCCCATTCTGAAGG - Intergenic
975466330 4:74713743-74713765 TGGCTTTGTTTACATGGTGAGGG + Intergenic
977025643 4:91815782-91815804 TGGCATTATTGTCACGGTGGTGG - Intergenic
977372606 4:96158726-96158748 TGGCATTAATCCCTTTGTTAGGG + Intergenic
977487751 4:97669943-97669965 TGGATTTATTCCCAATGTGAAGG + Intronic
978103873 4:104877146-104877168 TGGCATTAATCTCATCATGAGGG - Intergenic
978641673 4:110878248-110878270 TGGGATTATTCACTTGGAGATGG + Intergenic
982082441 4:151803941-151803963 GGGCATTAATCCCATCATGAGGG + Intergenic
982901939 4:161017058-161017080 TCTCATAATTCCCATGGTTATGG + Intergenic
983934004 4:173486371-173486393 TGGCATTATGTCAGTGGTGAAGG - Intergenic
984051776 4:174873315-174873337 TGGCGTTATTCCCTCTGTGATGG - Intronic
986110366 5:4709997-4710019 TGGCTTTGTTTACATGGTGAGGG - Intergenic
986528277 5:8704305-8704327 TAGCATTTTTCCCATTGTAAAGG - Intergenic
987011688 5:13772548-13772570 TGGCATTACTGCCTTGGTGATGG - Intronic
987415376 5:17656106-17656128 TGTCAATATTTCCATGATGATGG - Intergenic
988417190 5:30960203-30960225 GGGCCTTGTTCCCAAGGTGAGGG - Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
991006193 5:61830487-61830509 TGGCATTACTCCCATTTTAAAGG + Intergenic
991459377 5:66841618-66841640 GGGCATTAATCCCATCATGAGGG + Intronic
991917980 5:71624156-71624178 GGGCACTAATCCCATGGGGAGGG + Intronic
992368147 5:76114250-76114272 TGGCATTATTCCCATGGTGATGG - Intronic
993685734 5:90934919-90934941 GGGCACTAATCCCATGATGAGGG + Intronic
994968387 5:106703441-106703463 TGGCAGTATTGATATGGTGATGG + Intergenic
995364884 5:111347299-111347321 TGGCATTTTTCATCTGGTGAGGG + Intronic
997456661 5:134022520-134022542 TGGCATTAATCCAATCATGAGGG + Intergenic
999075534 5:148791936-148791958 TGGCATTTTTCACATGGCCAAGG + Intergenic
999171934 5:149602720-149602742 TGCCAGGATTCCCATGGTGAGGG + Intronic
1000281952 5:159789702-159789724 TGTCATTATTCCCATTTTAAGGG - Intergenic
1001090534 5:168736931-168736953 TGTCATTATTCCCATTTTGCAGG - Intronic
1001132214 5:169073636-169073658 TGGTGCTATTCCCATGGTAATGG + Intronic
1001337634 5:170813150-170813172 TGCCTTTATTCACATAGTGATGG + Exonic
1003564636 6:7212883-7212905 TGACATTTTTCCATTGGTGAGGG + Intronic
1003793108 6:9568680-9568702 TCTCATTAATCCCTTGGTGAAGG + Intergenic
1004581940 6:16962850-16962872 TGGCATTAATCCATTTGTGAGGG - Intergenic
1005845828 6:29777596-29777618 TGTCATTCTTCACATGGTGGTGG - Intergenic
1006474680 6:34246449-34246471 TGGAGTTGTTTCCATGGTGATGG - Exonic
1007804350 6:44428817-44428839 TGGCATTTTTCTCATCCTGAAGG - Intronic
1010835494 6:80582853-80582875 TGACATTAGTCCCAGTGTGATGG + Intergenic
1011167310 6:84463478-84463500 AGGCACTAATCCCATGATGAAGG - Intergenic
1011648831 6:89486863-89486885 GGGCACTAATCCCATTGTGAAGG + Intronic
1014159852 6:118155413-118155435 TGGCATTAATCCCATGATAATGG - Intronic
1014291187 6:119560701-119560723 TGGAATTATTCTCATGATGCTGG + Intergenic
1014400618 6:120985506-120985528 TAGCATTAATCCATTGGTGAGGG - Intergenic
1014522139 6:122457568-122457590 GGGCATTAATCCCATCCTGAGGG - Intronic
1017868811 6:158468887-158468909 GGGCACTAATCCCATCGTGAGGG + Intronic
1018192251 6:161320107-161320129 TTGTATTATTCCCACTGTGAAGG + Intergenic
1024978976 7:55140977-55140999 TAGAATCATTCCCATGGGGAAGG + Intronic
1026344828 7:69465095-69465117 TGACACTATTCACATGGAGATGG + Intergenic
1027711822 7:81613738-81613760 TGCCAATATTCCCATGATCAGGG + Intergenic
1028587298 7:92464854-92464876 TGGCATTATTCTGATGCTCAGGG - Intergenic
1030445056 7:109638698-109638720 TTGAATTATTTCCATTGTGATGG - Intergenic
1031114500 7:117653505-117653527 TGGCACTAATCCCATCATGAGGG + Intronic
1034835161 7:154345249-154345271 AAGCACTAATCCCATGGTGAGGG + Intronic
1035767193 8:2115989-2116011 TGGCATTATTGAGATGGTGATGG + Exonic
1037137583 8:15481308-15481330 TGGCATTAATCCATTGATGACGG - Intronic
1037948122 8:23002038-23002060 TGGCATTATTCTCACTGTCAAGG + Intronic
1041186754 8:55308761-55308783 GGGCATTATTCACCTGTTGAAGG - Intronic
1041409502 8:57537398-57537420 GGGCATTAATCCCATGATGGGGG + Intergenic
1049768366 8:144366519-144366541 TGGCATTAATCCCTTCATGAGGG + Intergenic
1055186589 9:73463673-73463695 CAGCATTATTCCCATGTTCATGG - Intergenic
1055402008 9:75933978-75934000 AGGCATTATTTTCATGATGAAGG + Intronic
1055663759 9:78532912-78532934 TGGCTTTATTCCCAGGGGGAGGG + Intergenic
1055801282 9:80039100-80039122 TGGCATAATTCCAATGATGCTGG + Intergenic
1056180845 9:84080754-84080776 TGGTTTTATTCCAATGGTAATGG + Intergenic
1057527254 9:95813797-95813819 TGGAAGTATTCTCTTGGTGAAGG + Intergenic
1057931190 9:99194815-99194837 GGGCACTAATCCCATTGTGAGGG - Intergenic
1059666616 9:116452438-116452460 TGTCAATAACCCCATGGTGACGG + Intronic
1060492052 9:124092262-124092284 GGGCATTAATCCCATCATGAGGG - Intergenic
1061647970 9:132021698-132021720 TGGCCTAATTCCCAATGTGATGG + Intronic
1187784116 X:22865506-22865528 TGGCATTATTCCATTCATGAAGG - Intergenic
1190177101 X:48159347-48159369 TGCCCTGATTCCCATGGTTACGG - Intergenic
1191766052 X:64699360-64699382 TGGCATTAATACCTAGGTGATGG - Intergenic
1193409339 X:81143856-81143878 TGGCTTTGTTTACATGGTGAGGG - Intronic
1194395094 X:93373467-93373489 TGGCATTGTGCCCAGGGTGAAGG + Intergenic
1197353328 X:125403620-125403642 TGTCAGTCTTCCCAAGGTGAGGG + Intergenic
1197629791 X:128845210-128845232 TGGCATTAATCCATTTGTGAGGG - Intergenic
1199997312 X:153033455-153033477 TGGCATGAGTCCAAAGGTGAAGG + Intergenic
1201453329 Y:14140661-14140683 TTGCATTAATTTCATGGTGATGG - Intergenic