ID: 992368182

View in Genome Browser
Species Human (GRCh38)
Location 5:76114608-76114630
Sequence CTGTCTTTTCTGAGGGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 229}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992368182_992368186 17 Left 992368182 5:76114608-76114630 CCTGATTCCCTCAGAAAAGACAG 0: 1
1: 0
2: 2
3: 17
4: 229
Right 992368186 5:76114648-76114670 CTTCTTTGAGCTTTCTTTTGTGG 0: 1
1: 1
2: 4
3: 52
4: 525
992368182_992368187 18 Left 992368182 5:76114608-76114630 CCTGATTCCCTCAGAAAAGACAG 0: 1
1: 0
2: 2
3: 17
4: 229
Right 992368187 5:76114649-76114671 TTCTTTGAGCTTTCTTTTGTGGG No data
992368182_992368188 30 Left 992368182 5:76114608-76114630 CCTGATTCCCTCAGAAAAGACAG 0: 1
1: 0
2: 2
3: 17
4: 229
Right 992368188 5:76114661-76114683 TCTTTTGTGGGCTAAACCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992368182 Original CRISPR CTGTCTTTTCTGAGGGAATC AGG (reversed) Intronic
903770129 1:25758580-25758602 CTGTCTTTTCAGTGGGAACTGGG + Exonic
903928441 1:26848594-26848616 CTGTGTTGTCTGAGGGAAGGAGG - Exonic
904963288 1:34351501-34351523 CTGTGTTTTCTGTTGGAATGGGG + Intergenic
905261030 1:36719429-36719451 CAGTCTCTTGTGAGGGAATGTGG - Intergenic
905826879 1:41032556-41032578 CTGGCTTTTCTGAGTGAAATAGG + Intronic
907977214 1:59443784-59443806 CTGTCTCTTCTGAGTGACACTGG + Intronic
908979510 1:69937696-69937718 CTGTCTCTTCTGCTGGAATTTGG + Intronic
910725490 1:90333957-90333979 CTGTCTTCTCTGGGGGACTGTGG + Intergenic
910818893 1:91324760-91324782 CTGTCTTTTCTTACAGAAGCAGG - Exonic
910846424 1:91609085-91609107 CAGTCTGTTCTCAGTGAATCTGG + Intergenic
912197329 1:107413480-107413502 CTGTCATTCCTCAGGAAATCTGG - Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
913543322 1:119842527-119842549 CTGTCTTTTCTCAGAGTATGAGG - Intergenic
915244668 1:154547859-154547881 CTCTCTTTTGAGAGGGAAGCTGG - Exonic
915952612 1:160199603-160199625 CCCTCTTTTCTGAGGAAAACTGG - Intronic
916817647 1:168369187-168369209 CTGTATTATCTGAGGGGATCTGG + Intergenic
917980309 1:180265149-180265171 CTGTCCTTTCAGGGGAAATCAGG + Intronic
921722773 1:218491921-218491943 CTGTCTGTTTTGATGGAATTTGG + Intergenic
921991728 1:221373958-221373980 CTGCCTTTTCAGAGAGATTCTGG + Intergenic
922975069 1:229777663-229777685 CTGTCTTTTCTATGGGACACCGG + Intergenic
923109715 1:230880831-230880853 TTGCTTTTTCTGAGGAAATCGGG - Intergenic
924712251 1:246539203-246539225 TTGTGTTTTCTGAGAGAATATGG + Intergenic
1063459801 10:6207910-6207932 CTGTGTGTTCTGAGGGATCCTGG + Intronic
1066028062 10:31385095-31385117 ATATCTTGTCTCAGGGAATCAGG - Intronic
1066802929 10:39209979-39210001 CTTTCTTTTCTGGAGGACTCTGG - Intergenic
1067089715 10:43260390-43260412 CTGTCTTATGTGAGGCAACCGGG - Intronic
1067481788 10:46605436-46605458 CTGTCTTCTATCAGGGTATCTGG + Intergenic
1067612963 10:47736293-47736315 CTGTCTTCTATCAGGGTATCTGG - Intergenic
1067934051 10:50593062-50593084 CTCTGTTTTCGGAGGGAAGCTGG + Intronic
1068946552 10:62735330-62735352 CTGCCATTTCTGAGTGATTCTGG + Intergenic
1070616208 10:77971275-77971297 CTCTTTTTTCTGAGGGATTAGGG + Intronic
1070650744 10:78233993-78234015 CTGCCTGTTCTGAGGGCACCAGG - Intergenic
1071628380 10:87196396-87196418 CTGTCTTCTATCAGGGTATCTGG - Intergenic
1071872009 10:89806361-89806383 TTCCCTTTTCTGAGGGGATCAGG + Intergenic
1072725197 10:97808423-97808445 CTTTCTTTCCTGATGGAGTCTGG + Intergenic
1073339436 10:102733760-102733782 CCATCTTTTGTGAGGGCATCAGG + Intronic
1081668414 11:44929939-44929961 CTCTCTTGTCTGGGGGAACCGGG - Exonic
1084082730 11:66839445-66839467 CTGTTTTATCTGAAGGACTCAGG - Intronic
1084419268 11:69052260-69052282 TTGTCTTCTCCCAGGGAATCTGG + Intronic
1084671282 11:70608005-70608027 CTGCCTTTTCTGTGTGACTCTGG - Intronic
1085799644 11:79577664-79577686 CTGTTTTTTATGAGAGACTCTGG - Intergenic
1085938860 11:81184305-81184327 CTCTGTGTTCTGAGTGAATCTGG + Intergenic
1088625876 11:111730146-111730168 CTGTCTTTTCAGAGGCAAAGTGG + Exonic
1088833601 11:113558878-113558900 GTGGCCTTTCTGAGGGAAACAGG - Intergenic
1088992096 11:114962542-114962564 CTGTCTTTACTGAGGGAGAAGGG - Intergenic
1089467903 11:118697428-118697450 CTGCCTTTTCTGGGGAAACCTGG - Intergenic
1090022236 11:123138107-123138129 CTGTCTCATCCGAGGGAATTAGG - Intronic
1090263947 11:125342459-125342481 CTCTCTTCTCTGAGGCAGTCAGG - Intronic
1090837851 11:130466346-130466368 CTTGCTTCTCTAAGGGAATCTGG + Intronic
1091162968 11:133442763-133442785 GTGTCTTTTTTGAGGGAAGAAGG + Intronic
1093019317 12:14188373-14188395 GTGTATTTTATTAGGGAATCAGG - Intergenic
1093306960 12:17532390-17532412 CTGTTTTGTCTCAGGGAATAGGG - Intergenic
1094739638 12:33274382-33274404 CAGTGTTTTTTGAGGGTATCAGG - Intergenic
1095308985 12:40673203-40673225 CTGCCTTTTCTAAAGGAATCTGG + Intergenic
1096985087 12:55750883-55750905 CTCTCTTGGCTGAGGGAATTTGG - Exonic
1097132049 12:56818924-56818946 GTATCTTTCCTGAGGGAATTGGG + Intergenic
1098034078 12:66284312-66284334 GTGTCTTTTCTTGGGGACTCAGG - Intergenic
1098297773 12:69021627-69021649 CATTATTTACTGAGGGAATCAGG + Intergenic
1100744283 12:97628486-97628508 CTGTCATTTCAGAAGGATTCGGG + Intergenic
1102708180 12:114901111-114901133 CTGTCTTTTCTGAGGAATGAGGG - Intergenic
1103050958 12:117779060-117779082 CTGTCTTTGCAGAGGGAAATTGG - Intronic
1104096509 12:125562962-125562984 ATGTCTCTTCTCAGGGAATAGGG + Intronic
1104111450 12:125708879-125708901 CTGCCTTTTCTCTGGGAAGCTGG + Intergenic
1105432729 13:20351916-20351938 CTGGCTTTTCTGAGGAATCCTGG - Intergenic
1105603064 13:21904131-21904153 CTGTCGTTTCTCAGGGACCCTGG + Intergenic
1106298226 13:28437852-28437874 CTGTCTTCTCTGCAGTAATCTGG + Intronic
1108916660 13:55622359-55622381 TTGTTTTGTCTCAGGGAATCAGG - Intergenic
1109366475 13:61363576-61363598 CTGTATTTTCTGAGGGGTACAGG + Intergenic
1109388439 13:61664382-61664404 TTGTCTTTACTGAGGGAAATTGG - Intergenic
1112926371 13:104679887-104679909 AAGTCTATTCTGATGGAATCAGG - Intergenic
1113286812 13:108858770-108858792 CTGGCTTTACTGAGTGAATTGGG - Intronic
1113906368 13:113821110-113821132 CTGCCCTTTCGGAGGGAACCCGG - Intronic
1114722860 14:24900832-24900854 CTGTCTTTTCTAAAGGAACCAGG + Intronic
1115166544 14:30454405-30454427 CTGTCTTTTTTGTGGGGAGCAGG - Intergenic
1115442545 14:33453046-33453068 CTGGCATCTGTGAGGGAATCAGG - Intronic
1120276706 14:82384325-82384347 GTTTGTTTTCTGAGGGAATCTGG + Intergenic
1121270617 14:92635349-92635371 CTGTCTTTTATTACGGAATTGGG + Intronic
1121475481 14:94197444-94197466 CTGTTTTTAATGAGGGATTCAGG + Intronic
1124711597 15:32017080-32017102 CTGTCCTTTCTGAGATATTCTGG - Intergenic
1125303666 15:38285449-38285471 GAGTCTTTTGTGATGGAATCTGG + Intronic
1126367295 15:47908304-47908326 CTGCCTTTGCAGAGGGAAGCTGG + Intergenic
1128719821 15:69940183-69940205 CTGTTTGTTCTGAGTGAGTCTGG - Intergenic
1129248346 15:74293673-74293695 CTGTTTTGTCTGTGGGCATCAGG - Intronic
1129617194 15:77107937-77107959 CTGTCTAATCTGAGGAAATCAGG - Exonic
1130092405 15:80831806-80831828 CTTTCTTGTCAGAGGGACTCTGG + Intronic
1131376543 15:91928947-91928969 CTTGCTTTTCTGAGCGAGTCAGG + Intronic
1132003185 15:98200738-98200760 CTCTCTCTTCTGAAGGAATGTGG - Intergenic
1132069041 15:98759296-98759318 CTGTCCTTTCTGGGGCACTCTGG - Intronic
1133322560 16:4923315-4923337 CTCTCTTTTCTGAGAGCATTTGG + Intronic
1133450993 16:5903909-5903931 CTGTCTTTGCTGAGGGAAGCTGG + Intergenic
1135584522 16:23658524-23658546 CTGTATTATCCGAGGGGATCTGG + Exonic
1137499296 16:48998033-48998055 CTGTCTTCTCTTCTGGAATCTGG + Intergenic
1138129814 16:54470066-54470088 CTGTCCTTTCACATGGAATCTGG + Intergenic
1139576971 16:67847673-67847695 CTGTCTTGTCTTAGAGGATCTGG + Intronic
1140647728 16:77051316-77051338 GTTTCTTTTCTGAGGCAATAAGG + Intergenic
1140887059 16:79253541-79253563 CTCTCTTTTCTAAGGGCCTCCGG + Intergenic
1141547998 16:84785248-84785270 CTGTGTCTTCTGATGGAAACAGG - Intergenic
1143741058 17:8954400-8954422 CTGTGTTTTCAGAGGGAGTAAGG - Intronic
1144449214 17:15361686-15361708 CAGTCTTTTCTTGGGGACTCTGG - Intergenic
1144747587 17:17626183-17626205 CTGTCCTGTCTGAGAGAACCGGG - Intergenic
1145266575 17:21382663-21382685 CTGTCTTTTCTGAGGCAACATGG - Intronic
1147014420 17:37479564-37479586 CTCTCTCTTCTGAGACAATCTGG - Exonic
1152971891 18:169966-169988 CTGTCTTGTCTCAGGGAATAGGG - Intronic
1152981427 18:281294-281316 TTGTCTTGTCTCAGGGAATAGGG - Intergenic
1157790063 18:50523692-50523714 CAGTCTTTTCTGAGAGACTTGGG + Intergenic
1159638932 18:70840370-70840392 CTGTCTATTCTTTGGGAAACTGG - Intergenic
1164628519 19:29745573-29745595 CTGTCTTTCCTGTGGAACTCAGG - Intergenic
1167312474 19:48745166-48745188 CTGGCTTCTCTGAGAGATTCGGG + Intronic
1167340021 19:48909912-48909934 AGGTCTTTACAGAGGGAATCAGG - Intronic
1167770522 19:51512517-51512539 CTCTATTTACTGAGGGAGTCTGG + Intergenic
925613149 2:5720265-5720287 CTGTCATTTCTGTCGGAATTTGG - Intergenic
926091708 2:10055453-10055475 CTGTGTTTTCTGAGGACATATGG - Intergenic
926828451 2:16933742-16933764 CTCTCTTTTCTGAGGGAAAGAGG - Intergenic
927386651 2:22541962-22541984 AGGTCTTTTCTGGGGGAAGCTGG + Intergenic
933158980 2:79003389-79003411 CTGTATGTTCTGAGACAATCAGG - Intergenic
933771195 2:85745285-85745307 CTTTCTTTTCTGAGGGAATGGGG + Intergenic
934652083 2:96098575-96098597 CTGTTTTCTCTGAGGGAAGTAGG - Intergenic
936778767 2:116006321-116006343 CTGTCTTTTTTTATGGATTCTGG - Intergenic
936938737 2:117861309-117861331 CTTTCTCTTTTGAGGGTATCAGG + Intergenic
937388289 2:121457324-121457346 CTGCCTTTACTCAGGGAATAGGG + Intronic
937566776 2:123302076-123302098 CTGTATTTATTGAGGTAATCAGG - Intergenic
940677187 2:156738795-156738817 GTTTCTTTTCAGAGGTAATCTGG - Intergenic
940767710 2:157807946-157807968 CTGTCTTTACTGAGAGACACTGG + Intronic
940834584 2:158506806-158506828 CACTCTAGTCTGAGGGAATCGGG - Intronic
941858506 2:170254413-170254435 CTGCCTTTCCTGCGGGACTCGGG + Intronic
943048732 2:182890296-182890318 CTGGGTTTTCTGAGGGATGCAGG - Intergenic
943468183 2:188256895-188256917 CTGTCTTTTTTGAGGACAACAGG + Intergenic
943999363 2:194812906-194812928 TTGTCTTCTCTGAGATAATCAGG + Intergenic
944710142 2:202328185-202328207 CTTTCTTTTCTGAGAGAAGGTGG - Intergenic
945773661 2:214078019-214078041 CTCTCTTTTCTGGGGAACTCAGG + Intronic
945939565 2:215934398-215934420 CTGTGGTTTCTGAGTAAATCAGG - Intergenic
945994790 2:216426989-216427011 CTCTCTTTTCTAAGTGACTCAGG + Intronic
946761201 2:222994923-222994945 CAGGGTTTTCTGAGGGAATGTGG + Intergenic
947136715 2:226983331-226983353 CTGTGTTTTCTGCGGGAATGTGG + Intronic
948224921 2:236301362-236301384 CTGTCTTTGCTTAGGTAACCAGG - Intergenic
1169689733 20:8316960-8316982 CTTTCTTGTTTGAGGGTATCTGG - Intronic
1170312607 20:15008992-15009014 CTGTCTTTACTCAGAGAAACAGG + Intronic
1170955243 20:20973556-20973578 CTGTCTTCTCGGAATGAATCAGG - Intergenic
1172493060 20:35357048-35357070 CAGTCTTTTCTGAATGATTCAGG - Intronic
1173105985 20:40134273-40134295 TTGTCTTTACTGAGGGCATGAGG - Intergenic
1173894877 20:46543081-46543103 CTGACTTTTCTGAATGACTCTGG - Intronic
1174931715 20:54823293-54823315 CTGTGGTTTCTGAGGCCATCAGG + Intergenic
1177991041 21:28036821-28036843 CTGGCCTTTCTGAGGAAAGCAGG + Intergenic
1179426287 21:41281106-41281128 CTGTCTCTCCTCTGGGAATCAGG + Intronic
1181841828 22:25669858-25669880 CTGTCTTTTCTCACAGATTCTGG - Intronic
1181844909 22:25699265-25699287 CTGTCTTTTCTCAGGCACACGGG + Intronic
955949195 3:64225114-64225136 CTGTTTTCCCTGAGGGAATGTGG - Exonic
956221397 3:66907666-66907688 CTGTAATTGCTGAGGGAACCAGG - Intergenic
958892509 3:99796049-99796071 CAGCCTGTTCTGAGGGCATCTGG - Exonic
958991968 3:100856863-100856885 CTGTGTTTTCTGTGGGCACCAGG - Intronic
961373032 3:126443102-126443124 CTGTCTTTTCTGGGTGCCTCAGG + Intronic
962237431 3:133718460-133718482 CTGTGTTTTCTCTGGGAAGCAGG + Intergenic
962446849 3:135473607-135473629 CTGCCTTCTCTGAGGGAACCTGG - Intergenic
962707590 3:138060483-138060505 CTGTCATTTATTAGGGAAACTGG + Intergenic
963208145 3:142657442-142657464 CTTTCTTATCTGAGGGACTCTGG - Intronic
964537401 3:157738880-157738902 ATGTCTTTTATGAGGGAAGTTGG - Intergenic
964940125 3:162149143-162149165 CTCTCTTTTCAAAGGGAATTGGG - Intergenic
967057983 3:185846836-185846858 ATGTCTTTTCTGAGAGAAGGAGG + Intergenic
968419199 4:468416-468438 CTTTTTTTTGTGACGGAATCTGG - Intronic
970816642 4:20163864-20163886 CTGTCTTATCTCAAGCAATCAGG - Intergenic
970895424 4:21097732-21097754 ATGTTTTTTCTCAGGGAATATGG - Intronic
972615416 4:40693517-40693539 TTGTTGTTTCTTAGGGAATCGGG + Intergenic
973059387 4:45701506-45701528 GTGTCTTCTCTGAGCCAATCAGG - Intergenic
973259332 4:48145531-48145553 CTGACCTTTATGAGGGAATTGGG - Exonic
978371144 4:108030382-108030404 CTCTCTTTTCTGGGGCACTCTGG + Intronic
979600779 4:122584632-122584654 CTTTCATTTCTGAGGCAAACTGG + Intergenic
979970814 4:127132633-127132655 CTGGCTTTGCTGAGGGGGTCGGG - Intergenic
980957206 4:139441423-139441445 CTTTATTTTCTAAGGGACTCAGG + Intergenic
981197721 4:141940725-141940747 CTTTCTTTTCTGAAGGACACTGG - Intergenic
983604031 4:169565120-169565142 ATGTCTTTTCTGAGGTAAAGTGG - Intronic
984621929 4:181963536-181963558 CTATATTTTCTTAGGGAATCAGG - Intergenic
985902741 5:2809331-2809353 CTGTCTTTTCTGCAGGAACCTGG + Intergenic
989324671 5:40178179-40178201 CTGTTTTGTCTCAGGGAATAGGG + Intergenic
991333756 5:65523880-65523902 CTGTCTTTTAAGATGGAATGTGG - Intronic
991716235 5:69453490-69453512 CTTTCTTTTCTGAGGGGCTAGGG + Intergenic
992368182 5:76114608-76114630 CTGTCTTTTCTGAGGGAATCAGG - Intronic
995824400 5:116278043-116278065 CTATCTTGGCTGAGGGATTCTGG - Intronic
995913053 5:117210995-117211017 CTGTCATTTCTGAGGAATTTGGG - Intergenic
996570265 5:124926459-124926481 TTTTCTTTTGAGAGGGAATCTGG + Intergenic
996700230 5:126443644-126443666 CTGTCTTTTCTCAGTAAAACTGG + Intronic
998011991 5:138702854-138702876 CTGTGTGTTCTGAGGGAGTAAGG + Intronic
1000568341 5:162880329-162880351 CTGGTTCTTCTGAGGCAATCAGG + Intergenic
1000993961 5:167940198-167940220 CTTTCATTTCTGATGGAATTTGG + Intronic
1001319795 5:170671043-170671065 CTGTGTCTTCTGAGGCAGTCTGG + Intronic
1002769708 6:280713-280735 CTGTTTTTTCTCATGGAATTTGG + Intergenic
1003441864 6:6150285-6150307 CTGTCGTTTCTGACGAAAGCAGG + Intronic
1003720445 6:8695979-8696001 TTGTAATTTCTTAGGGAATCAGG + Intergenic
1004475351 6:15966374-15966396 CTGTCTTTTTTCAGGGAAACTGG - Intergenic
1005219127 6:23566012-23566034 CTGTATTTACTGAGAGAATAGGG - Intergenic
1005245997 6:23885800-23885822 CTATCTTTCCTGAAGGAATGTGG - Intergenic
1006138103 6:31908940-31908962 CTGGCTTTATTGAGGGGATCTGG + Intronic
1007330139 6:41100767-41100789 CTGTCTTTTCTACTGGAAACGGG - Intergenic
1007362414 6:41368506-41368528 CTGTCCTTTCTCTGGGATTCAGG - Intergenic
1008525061 6:52399348-52399370 CTGTCTGTTCTGAGGGAGAAAGG - Intronic
1008922892 6:56861627-56861649 CTCTCTTTCCTGAGGTGATCTGG + Intronic
1009848886 6:69170575-69170597 CTTTCTTTTCTGGGGAAATGTGG - Intronic
1010043286 6:71412362-71412384 CTGTCTTTTTTGTTGGAATTGGG - Intergenic
1012328974 6:97960519-97960541 CTGTCTTTCCTGCAGGACTCTGG + Intergenic
1012716779 6:102684046-102684068 CTGTATTTTCTTAGAGATTCGGG - Intergenic
1013111949 6:107071153-107071175 GAGTCTTTTCTCAGGGAATGGGG - Intronic
1013155215 6:107486891-107486913 CTGTGTTTTCTAGGTGAATCAGG + Intergenic
1015254781 6:131165982-131166004 CTATATTTCCTGAGGGAATGAGG + Intronic
1016629520 6:146212092-146212114 ATGTATTAACTGAGGGAATCAGG + Intronic
1016792601 6:148081076-148081098 CTCCCTTTTCTGAGGGAGTTGGG + Intergenic
1018793167 6:167165531-167165553 CTGTCTTTGCTGATGGAAGCTGG - Intronic
1020275684 7:6623119-6623141 TGGTATTTTCTCAGGGAATCCGG - Exonic
1020591714 7:10147371-10147393 CTCTCTTTTCTTAGGGTCTCTGG - Intergenic
1022829044 7:34046292-34046314 CTCTCTTTTCTTAGGGAGGCAGG + Exonic
1023183898 7:37513757-37513779 CTGTGACTTCTGAGGGTATCAGG - Intergenic
1023386871 7:39667332-39667354 CTGTCTTTTCACAGGGAGTTGGG - Intronic
1025770838 7:64504659-64504681 CAGTTTTTTCTGAGTGACTCAGG - Intergenic
1029046538 7:97635249-97635271 CTGACTTTGCTGAAGAAATCTGG + Intergenic
1029353990 7:100037041-100037063 ATGTGTTTTCTGAGGAAAACAGG + Exonic
1033795295 7:144838399-144838421 CTGTCGTGTCTTAGGGAATAGGG - Intergenic
1034690693 7:153011284-153011306 CTGTATTTTCAGAGGAAGTCAGG + Intergenic
1037881794 8:22577102-22577124 ATATGTTTTATGAGGGAATCAGG - Intergenic
1038120564 8:24609633-24609655 ATGTCTTTACAGAGGCAATCAGG + Intergenic
1040841078 8:51785748-51785770 CTGTTCTTTCTCAGGGAATTGGG - Intronic
1041202879 8:55468082-55468104 CTGTCTTCTGTGATGGAAACTGG - Intronic
1041458313 8:58084109-58084131 CTGTCTTTCCTGAGGTCAGCAGG + Intronic
1041725887 8:61017066-61017088 CTGTCTTTTTGGAGAGAAGCAGG - Intergenic
1043135783 8:76522469-76522491 CTGTTTTTTCTGAGGGCTACTGG + Intergenic
1044244399 8:89925269-89925291 CTGTCTTTTCTGAAGGATCAAGG + Exonic
1045896712 8:107227032-107227054 CAGTCTTCTCTTTGGGAATCAGG + Intergenic
1046104655 8:109651034-109651056 CTGTCTTTTCTCAGATTATCAGG + Intronic
1047231336 8:123000629-123000651 CTTTCTTTTTTGATGGAGTCTGG - Intergenic
1047765678 8:127988085-127988107 TTGTCTTCTCTGAGGCACTCTGG - Intergenic
1048351236 8:133618380-133618402 CTGTGTTGACTTAGGGAATCAGG + Intergenic
1050112704 9:2233184-2233206 CTGTGTTTTCTCAAGGTATCTGG + Intergenic
1050174741 9:2857944-2857966 CTGTCTGTTCTGAGGCAATTCGG + Intergenic
1050177838 9:2887135-2887157 CTGTCATTTCTGATGGTATTTGG - Intergenic
1051254137 9:15194891-15194913 TTGTTTTGTCTGAGGGAATAGGG - Intronic
1054745136 9:68846392-68846414 CTGTCTTTTCTGAAAGAGTGGGG - Intronic
1055575162 9:77653892-77653914 CAGTCTTTTGGAAGGGAATCTGG - Intergenic
1057523127 9:95775818-95775840 GTGTCTTTTCTGGGAAAATCTGG + Intergenic
1058812061 9:108650081-108650103 CTGTATTTTCAGACGGATTCAGG - Intergenic
1059680525 9:116581129-116581151 CAGTCTTTTCTGAGGGCATTTGG + Intronic
1061122434 9:128652080-128652102 CTGTGATTTCTGAGCCAATCTGG - Intronic
1061579141 9:131526215-131526237 CTGTCTTCTGTGATGGAATGGGG - Intronic
1186330534 X:8527342-8527364 CTGTCTTTTGTGGGGGAAATTGG + Intergenic
1188113716 X:26220033-26220055 CTGTCTTTACTAAGAGAACCAGG + Intergenic
1189151035 X:38706963-38706985 CTGTCTATTCTTAGAGATTCTGG - Intergenic
1189631244 X:42955823-42955845 CTGACTTTTCTGAGGAATTTTGG - Intergenic
1200170529 X:154070269-154070291 CTGTCTTGTCCAAGGGAATAGGG - Intronic
1200963791 Y:9018432-9018454 CTGTCTTCTCTGTGGGATCCAGG - Intergenic
1201685694 Y:16699626-16699648 CTGTATATTCTGAGGAATTCAGG - Intergenic
1201711863 Y:17001108-17001130 CTGTCTTTTCTAAGGAAAAAGGG + Intergenic
1201945335 Y:19504463-19504485 CAGACTTTCCAGAGGGAATCGGG + Intergenic
1202149313 Y:21830356-21830378 CTGTCTTCTCTGTGGGATCCAGG + Intergenic