ID: 992369380

View in Genome Browser
Species Human (GRCh38)
Location 5:76127156-76127178
Sequence GTGATGAGGAGTAAAGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992369376_992369380 0 Left 992369376 5:76127133-76127155 CCAAGATCTTTTGATTGATGGTG 0: 1
1: 0
2: 1
3: 12
4: 225
Right 992369380 5:76127156-76127178 GTGATGAGGAGTAAAGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992369380 Original CRISPR GTGATGAGGAGTAAAGCAAA GGG Intronic
No off target data available for this crispr