ID: 992371786

View in Genome Browser
Species Human (GRCh38)
Location 5:76151414-76151436
Sequence TGACATGGTGAAATGTCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992371784_992371786 14 Left 992371784 5:76151377-76151399 CCAATGGGGAGTGGTTGACGTGT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 992371786 5:76151414-76151436 TGACATGGTGAAATGTCATTTGG 0: 1
1: 1
2: 1
3: 21
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992371786 Original CRISPR TGACATGGTGAAATGTCATT TGG Intronic
902316652 1:15625331-15625353 TGGCCTGGTGAAAAATCATTAGG + Intronic
905268725 1:36772677-36772699 TTACATATTGAGATGTCATTTGG - Intergenic
906803751 1:48759756-48759778 TTACATGGTGAATTGCCTTTAGG - Intronic
908973648 1:69869123-69869145 TGATGTGGTTAAATTTCATTTGG + Intronic
909112648 1:71499132-71499154 TGACAAAATGAACTGTCATTAGG + Intronic
911502441 1:98704938-98704960 TGACATAGTCAAATGTCCTCTGG - Intronic
912012348 1:104982948-104982970 TTAAATGGTGAAATGAGATTTGG - Intergenic
912311135 1:108622486-108622508 GGACATGGGAAAATGTTATTAGG + Intronic
913980395 1:143503802-143503824 TGAAATGGTGAAATGAAATGAGG + Intergenic
914074733 1:144328384-144328406 TGAAATGGTGAAATGAAATGAGG + Intergenic
914074742 1:144329279-144329301 TGAAATGGTGAAATGAAATGAGG + Intergenic
914074751 1:144330189-144330211 TGAAATGGTGAAATGAAATGAGG + Intergenic
914104425 1:144636257-144636279 TGAAATGGTGAAATGAAATGAGG - Intergenic
914104434 1:144637167-144637189 TGAAATGGTGAAATGAAATGAGG - Intergenic
914104443 1:144638062-144638084 TGAAATGGTGAAATGAAATGAGG - Intergenic
914212742 1:145595436-145595458 TCATATGGTGGAATATCATTTGG - Intergenic
917329055 1:173862962-173862984 TGAGATTGTGAAATGACAATGGG + Intergenic
919128326 1:193424060-193424082 TCACATTCTGAAATTTCATTGGG + Intergenic
919247767 1:195011089-195011111 TGCCCTGGTCAAATGTCATGGGG - Intergenic
920636959 1:207713377-207713399 TGACATGAAGATATGTAATTGGG - Intronic
1063927074 10:10990790-10990812 TGACTTAGTAAAATGTCAGTTGG - Intergenic
1064697285 10:17980563-17980585 TGAGATGGACAAATGTCTTTTGG + Intronic
1064942234 10:20747716-20747738 TGGCATGGTGGAAAGGCATTTGG - Intergenic
1065248938 10:23789835-23789857 TGCCATGTAGAAATTTCATTTGG + Intronic
1065772631 10:29091803-29091825 CAACATGGAAAAATGTCATTTGG - Intergenic
1065895329 10:30158366-30158388 GGACATGGTGGAAGGTGATTGGG + Intergenic
1067922464 10:50473998-50474020 TGTCATGGTGAAAGGTCAAGAGG + Intronic
1068331901 10:55581999-55582021 TGTAATGGTGGAATGTAATTGGG + Intronic
1070977689 10:80618459-80618481 AGCCATGGTTAAATTTCATTTGG + Intronic
1071224645 10:83514597-83514619 TGACATGGTGAAATGTACAATGG + Intergenic
1072833033 10:98679401-98679423 TGACATTGTCACATGTCATATGG - Intronic
1075246383 10:120825658-120825680 AGACATTGTCAAATGTCTTTAGG + Intergenic
1075356419 10:121781130-121781152 TGACATGATCAAATGACATGAGG + Intronic
1075431620 10:122388063-122388085 TGAAAGTATGAAATGTCATTGGG - Intronic
1076763380 10:132616728-132616750 TGACATGGCGATGTGTCATGTGG + Intronic
1078837765 11:15048138-15048160 TGAAATGGTGAAATGTCATTAGG - Intronic
1079326823 11:19500266-19500288 TGACATGGTCAAATGGCTGTTGG - Intronic
1079390583 11:20018789-20018811 TCATATGGTGGAATGTAATTGGG + Intronic
1079705129 11:23606126-23606148 TGTCCTTGTGAAACGTCATTCGG + Intergenic
1079940030 11:26668912-26668934 TGACCTAGTGAAATGTCTTTAGG + Exonic
1080312497 11:30911404-30911426 TCACAAGGTGAAAGGTCCTTGGG + Intronic
1080438228 11:32266141-32266163 TCTCGTGTTGAAATGTCATTTGG - Intergenic
1083991482 11:66248664-66248686 TGAAATGGAGAAAGGACATTAGG - Intergenic
1084787374 11:71450703-71450725 TCACTGGGTGAAAGGTCATTTGG - Intronic
1088757979 11:112902578-112902600 TGACAGGCTGAAATGCCTTTGGG - Intergenic
1090655367 11:128839487-128839509 TGACATGGTAAATTGTCAATGGG + Exonic
1091163115 11:133444717-133444739 TATCATGATGAAATGTTATTAGG - Intronic
1092523140 12:9293591-9293613 TAAAATGGGGAAAGGTCATTTGG + Intergenic
1092544151 12:9438308-9438330 TAAAATGGGGAAAGGTCATTTGG - Intergenic
1093065772 12:14656739-14656761 GGACATGGTGTTCTGTCATTGGG - Intronic
1093196899 12:16140307-16140329 TCACAAGGTGAAACGTCCTTTGG - Intergenic
1094123834 12:27001648-27001670 TGTCTTGCTGTAATGTCATTAGG + Intronic
1094508793 12:31083742-31083764 TAAAATGGGGAAAGGTCATTTGG + Intronic
1094629817 12:32162399-32162421 TGACATGGATAAATGACATGAGG + Intronic
1095225513 12:39672770-39672792 GGACATGGGAAAATGTCAGTGGG + Intronic
1099356954 12:81649471-81649493 TGCCAAAATGAAATGTCATTTGG - Intronic
1099651684 12:85436124-85436146 AAACATAGTGAACTGTCATTAGG - Intergenic
1100059562 12:90557967-90557989 TCACATGGTGAAAGGAGATTGGG + Intergenic
1104369779 12:128214429-128214451 TGATAGGGTGAAATGTCCTTTGG - Intergenic
1106451591 13:29887403-29887425 TGACGAGGTGAAAGGTCAGTGGG + Intergenic
1108070211 13:46620852-46620874 TCACATGCTGAAATGTTATGGGG + Intronic
1110070168 13:71165236-71165258 TTACATGGCAAAATGTAATTAGG - Intergenic
1110878170 13:80536977-80536999 AGATATGTTGAAATATCATTTGG - Intergenic
1110895993 13:80753314-80753336 TGAAATGCTGAATTGACATTTGG + Intergenic
1111658729 13:91182601-91182623 ACACATGGTAAAATGTGATTTGG - Intergenic
1112224126 13:97521060-97521082 TGGCATGAGGAAATGTCATATGG + Intergenic
1113173034 13:107528017-107528039 TGACAAAATGAATTGTCATTAGG + Intronic
1116951164 14:50879888-50879910 TCCCATGGTGACATGTCATATGG + Intronic
1118871918 14:69750220-69750242 AGAATTGGTGAAAGGTCATTAGG + Intronic
1119931612 14:78553112-78553134 TGACTTGGTAAAATGTCTGTAGG + Intronic
1120126066 14:80744888-80744910 TGACCTGGGGAAATGGCAGTTGG - Intronic
1120486884 14:85125283-85125305 TGACAGGGTGAAGTGACAGTAGG + Intergenic
1120677752 14:87441757-87441779 AGAAATGTAGAAATGTCATTTGG - Intergenic
1121972543 14:98371748-98371770 TGACATGGTTACATGGCCTTGGG - Intergenic
1202939443 14_KI270725v1_random:133255-133277 TGAAATGGTGAAATGAAATGAGG - Intergenic
1125773486 15:42189164-42189186 TGATTTGTTGAAATGTCAATAGG + Exonic
1126689229 15:51274997-51275019 TAACTTGGTGACATGTCACTTGG + Intronic
1127127189 15:55823133-55823155 GGACATTGTGAAATGGAATTTGG - Intergenic
1128401986 15:67292697-67292719 TTAAGGGGTGAAATGTCATTAGG - Intronic
1128714556 15:69898235-69898257 TGAGATTGTCAAATGTCATAAGG + Intergenic
1129209525 15:74059573-74059595 TAACATGATGAAAGGACATTTGG - Intergenic
1129477697 15:75797179-75797201 TAACATGATGAAAGGACATTTGG + Intergenic
1131335627 15:91546032-91546054 TGACTTGGTGCAATGTCTGTAGG - Intergenic
1132512212 16:349189-349211 TTAGCTGCTGAAATGTCATTGGG - Intronic
1134338458 16:13323413-13323435 TGACATGGTTAAATATAGTTTGG + Intergenic
1135569700 16:23539390-23539412 TAATAAAGTGAAATGTCATTGGG - Intronic
1135596555 16:23748795-23748817 TGACATTCAAAAATGTCATTTGG - Intergenic
1136177657 16:28529037-28529059 TGACACGGTGAAAGGTGAATAGG - Intergenic
1136715998 16:32282147-32282169 TGAAATGGTGAAATGAGATGAGG + Intergenic
1136751914 16:32647652-32647674 TGAAATGGTGAAATGAGATGAGG - Intergenic
1136767947 16:32806700-32806722 TGAAATGGTGAAATGAAATGAGG - Intergenic
1136822675 16:33332817-33332839 TGAAATGGTGAAATGAGATGAGG + Intergenic
1136829238 16:33389356-33389378 TGAAATGGTGAAATGAGATGAGG + Intergenic
1136834304 16:33488138-33488160 TGAAATGGTGAAATGAGATGAGG + Intergenic
1136902598 16:34054666-34054688 TGAAATGGTGAAATGAAATGAGG + Intergenic
1136958093 16:34807473-34807495 TGAAATGGTGAAATGAAATGAGG + Intergenic
1137860731 16:51844045-51844067 TGAGAGGGTCAAATGTCATTTGG - Intergenic
1138277627 16:55747484-55747506 TGACAGGGTTGAATGTCATTGGG + Intergenic
1138283558 16:55790946-55790968 TGACAGGGTTGAATGTCACTGGG + Intergenic
1138285444 16:55806041-55806063 TGACAGGGTTGAATGTCACTGGG - Intronic
1140545104 16:75800133-75800155 TTTCATGTTGAAATATCATTAGG + Intergenic
1140748539 16:78002708-78002730 TGTCATGGTGAGATGACACTGGG - Intergenic
1141188306 16:81804797-81804819 GAACCTGGAGAAATGTCATTGGG + Intronic
1141219758 16:82058575-82058597 TTACATGGGCAAAAGTCATTAGG + Intronic
1203010612 16_KI270728v1_random:236382-236404 TGAAATGGTGAAATGAGATGAGG - Intergenic
1203070338 16_KI270728v1_random:1068737-1068759 TGAAATGGTGAAATGAAATGAGG - Intergenic
1143855718 17:9847172-9847194 AGACATGTAGAAATGTAATTAGG + Intronic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1146774476 17:35600752-35600774 TGACATGGTAAAATATCAATAGG + Intronic
1149371709 17:56000982-56001004 TGAAATGTTGAAATCTCCTTTGG - Intergenic
1150002418 17:61450288-61450310 TGACATGGAGAAATGAGATATGG - Intergenic
1154517862 18:15194188-15194210 TGAAATGGTGAAATGAAATGAGG - Intergenic
1156223963 18:35083631-35083653 TGACTTGGTAAAATATGATTTGG - Intronic
1156376225 18:36517586-36517608 TTACATGGAGAAATTTAATTTGG + Intronic
1158119244 18:54030068-54030090 TAAAATGGTGAATTGTCCTTGGG - Intergenic
1158942703 18:62420417-62420439 TGAGATGGAGAAATGTGAATTGG - Intergenic
1159223086 18:65491057-65491079 TGCTATGGTGATATGTCTTTAGG + Intergenic
1164210774 19:23095558-23095580 GGACATTGTGACATGTCACTGGG + Intronic
1164243129 19:23407758-23407780 GGATATTGTGAAATGTCACTAGG - Intergenic
1164303664 19:23984387-23984409 AGACATTGTGACATATCATTAGG - Intergenic
926817816 2:16817630-16817652 TGACTTGGTCAAATGTCATGTGG + Intergenic
928402925 2:30992365-30992387 TCACATGGTGAAATGTCCAACGG + Intronic
932535627 2:72591697-72591719 TAACAAGGTTAAATTTCATTAGG - Intronic
933338165 2:80986413-80986435 TGACATGTTTAAATTTCAGTAGG + Intergenic
934251158 2:90356644-90356666 TGAAATGGTGAAATGAAATGAGG - Intergenic
934251162 2:90356789-90356811 TGAAATGGTGAAATGAAATGAGG - Intergenic
934258399 2:91446613-91446635 TGAAATGGTGAAATGAAATGAGG + Intergenic
934258404 2:91446766-91446788 TGAAATGGTGAAATGAAATGAGG + Intergenic
934689255 2:96345687-96345709 GGACATGGTGAAGTGTCATGAGG + Intronic
936393355 2:112096681-112096703 TCACATTGTGACATGCCATTTGG - Intronic
936663075 2:114563863-114563885 AGAGATGGTGTAATGTCAGTTGG - Intronic
938147071 2:128844039-128844061 TCATATGGTGAAATATCACTTGG - Intergenic
938517777 2:132034541-132034563 TGAAATGGTGAAATGAAATGAGG - Intergenic
938517781 2:132034850-132034872 TGAAATGGTGAAATGAAATGAGG - Intergenic
939908662 2:147951553-147951575 TGACATGGTGGAAGGTCAAATGG - Intronic
940273605 2:151916788-151916810 GGACATTGTGAAATGTCCCTTGG - Intronic
941109170 2:161398821-161398843 TTAAATGGAGAAATCTCATTTGG + Intronic
943738626 2:191386474-191386496 TGAGATTTTGAAATGACATTAGG + Intronic
945477732 2:210305323-210305345 TGACATTTTGAAAGGTTATTGGG + Intronic
945711031 2:213294553-213294575 TAACATAGTGAAAAGTAATTAGG - Intronic
946816263 2:223581888-223581910 TGAGATGGTGACATTTCATCAGG - Intergenic
947602479 2:231463034-231463056 TGACATGTCAAGATGTCATTTGG - Intronic
1169900175 20:10544822-10544844 TTACATGGTGAAACTTCATCAGG + Intronic
1170959505 20:21012682-21012704 TGACAGTGGGAAATGTCATTAGG - Intergenic
1173457006 20:43210894-43210916 TGAGATGATGAACTGTTATTAGG - Intergenic
1173678663 20:44860565-44860587 TCACATGGTGAAAGGTCAAGAGG + Intergenic
1173975049 20:47180610-47180632 TGACATAGTGAAATGTAGTATGG - Intronic
1174041787 20:47705383-47705405 TCACAGAGTGAAATGTAATTAGG + Intronic
1174555759 20:51394339-51394361 TGGCATGGTGAAAGGGCACTGGG - Intronic
1175079181 20:56404042-56404064 TGACATGAGGAATTTTCATTTGG + Exonic
1176716748 21:10357516-10357538 TGACCTGGTCACCTGTCATTTGG + Intergenic
1177775953 21:25566291-25566313 TGACATGGTAAAAAGTTGTTTGG + Intergenic
1180601589 22:17022444-17022466 TGACCTGGTCACCTGTCATTTGG - Intergenic
1184007056 22:41718025-41718047 TGACATTGTGAAATTTCCCTTGG + Intronic
949165182 3:931862-931884 TGACATGGTCCAATGTGGTTTGG - Intergenic
949553970 3:5136318-5136340 TGACACAGTTAATTGTCATTTGG + Intronic
950440836 3:13009364-13009386 TGACATGGTGTAATGTCATCAGG + Intronic
952180995 3:30916534-30916556 TGATCTGGTTAAATGCCATTTGG + Intergenic
952541942 3:34376098-34376120 TCACACTGTAAAATGTCATTTGG - Intergenic
953037163 3:39222935-39222957 TCATATAGTGAAATGTTATTTGG + Intergenic
956368858 3:68536367-68536389 TGACATTATCATATGTCATTTGG + Intronic
957200799 3:77133649-77133671 TTACAGGGTGAATTTTCATTAGG - Intronic
957264895 3:77950247-77950269 TGACATGGTGCATTGGCATTTGG - Intergenic
957265812 3:77964178-77964200 TGACATGCTAAAATGAAATTTGG - Intergenic
959434683 3:106299907-106299929 TGACATAGTTAAATGTCAAGTGG + Intergenic
960081078 3:113541187-113541209 TGACAGAGAGAAATGTCATCAGG - Intronic
960628548 3:119704473-119704495 TAACAAGGTGAAAGGTCATAAGG - Intronic
964516505 3:157514882-157514904 TGACATGTTGAAGTGTAACTTGG - Intronic
964938602 3:162125725-162125747 TGACATGTGGACATGTCACTGGG - Intergenic
966459309 3:180157930-180157952 TGCCATTGTCAAAAGTCATTTGG + Intergenic
966839763 3:184078895-184078917 TGAAAAGGTGAACTGTCACTGGG + Intergenic
967768809 3:193311833-193311855 TGAAATGCTGAAATATCACTTGG + Exonic
968127887 3:196173689-196173711 TGACTCGGTGAAATGTCTTGTGG - Intergenic
968429616 4:548976-548998 TTTCATGCTGAAATGTCAGTGGG + Intergenic
969145910 4:5123881-5123903 TGAAAAGGTGAAATGACATGAGG - Intronic
971617497 4:28811511-28811533 TGACATAGTAATATGTCATTGGG + Intergenic
971936789 4:33160272-33160294 AGACATTGTGAAATGTCCTCTGG - Intergenic
972996604 4:44886544-44886566 AGACATTGTGAAATGTCCCTTGG + Intergenic
974381966 4:61152663-61152685 TCTCATGGGGAAATGGCATTTGG - Intergenic
974791379 4:66694614-66694636 TGAAATGGTAAAATGTATTTTGG + Intergenic
975938375 4:79610052-79610074 TGACTTGGTCAAGTGGCATTTGG - Intergenic
976422877 4:84866197-84866219 TGATATGCTGAAGTGTTATTTGG - Intronic
976427356 4:84920984-84921006 TGACATATTCAAATTTCATTGGG - Intronic
977627599 4:99204173-99204195 TGAGTTGGTGAAATATCCTTTGG + Exonic
977877726 4:102168709-102168731 GGCCAGGGTGAAATGTGATTAGG + Intergenic
978255754 4:106691190-106691212 TGACATGATGAAATAGTATTAGG + Intergenic
979500193 4:121431271-121431293 GGAAATGATGAAATGTCTTTTGG - Intergenic
979511165 4:121555552-121555574 TTACATGTTGAAATTTCATTAGG + Intergenic
979957525 4:126972977-126972999 TGACATGGTGAGATTGGATTGGG - Intergenic
981087159 4:140696086-140696108 TGACATGGAGAACTTTAATTGGG - Intronic
983041009 4:162926463-162926485 TGACCTGGTAATATGTCTTTAGG - Intergenic
984612762 4:181858928-181858950 TGACATGATGAAAAGGTATTTGG + Intergenic
986051285 5:4092408-4092430 TGGCATGGTGAGATGTTATGTGG - Intergenic
987259723 5:16190895-16190917 AGACATGGTGAAATGTCCGCTGG - Intergenic
988151706 5:27391357-27391379 TGAAATGTTGAAATGTAATGGGG - Intergenic
990886299 5:60598228-60598250 AGAAATGATGAAATGTAATTGGG - Intronic
992371786 5:76151414-76151436 TGACATGGTGAAATGTCATTTGG + Intronic
995829153 5:116334471-116334493 AGACATAGTGAAATGACAGTGGG - Intronic
996007754 5:118443570-118443592 CAACATGGTGAAATGCCATTTGG + Intergenic
996153481 5:120068737-120068759 TGTTATGGAGAAATTTCATTGGG + Intergenic
997637774 5:135427360-135427382 TGACCTGGTGAAAGTTCATTGGG - Intergenic
997638500 5:135433037-135433059 AGACATTGTGAAATGTCCTCTGG + Intergenic
1001013939 5:168123824-168123846 GGAAATGATGCAATGTCATTTGG - Intronic
1004043003 6:12000368-12000390 GGACACTGTCAAATGTCATTTGG + Intergenic
1006888611 6:37403880-37403902 TGACTTTGTCAAATGTCAGTTGG + Intergenic
1007550360 6:42725020-42725042 TGAAAAGATCAAATGTCATTAGG - Intergenic
1008103946 6:47422730-47422752 TGATGTGGTCAAATGACATTTGG - Intergenic
1014211586 6:118713984-118714006 TGAAAAGGTGAGATGTTATTAGG + Intergenic
1015907391 6:138130861-138130883 GGACCTGGTGAAAGGTGATTGGG - Intergenic
1017371299 6:153712243-153712265 AAACATGGTGAAATTTTATTTGG - Intergenic
1017934707 6:158995217-158995239 TAACATAGTGAGATGTCATTGGG - Intronic
1021477082 7:21074291-21074313 TGACCTAATGAAATGTTATTTGG - Intergenic
1021873873 7:25030550-25030572 AAACATGGTGAAGGGTCATTGGG - Intergenic
1024374370 7:48620555-48620577 TGACATTGGCAAATGTCTTTTGG + Intronic
1025482306 7:60996200-60996222 TGAAATGGTGAAATGAAATGAGG + Intergenic
1025784030 7:64627811-64627833 GGACATTGTGACATATCATTGGG + Intergenic
1025840834 7:65145201-65145223 TGAAATGGTGAAATGAAATGAGG + Intergenic
1025840841 7:65145819-65145841 TGAAATGGTGAAATGAAATGAGG + Intergenic
1025877874 7:65504305-65504327 TGAAATGGTGAAATGAAATGAGG - Intergenic
1025877882 7:65504891-65504913 TGAAATGGTGAAATGAAATGAGG - Intergenic
1025882207 7:65550152-65550174 TGAAATGGTGAAATGAAATGAGG - Intergenic
1025882214 7:65550777-65550799 TGAAATGGTGAAATGAAATGAGG - Intergenic
1025891228 7:65651843-65651865 TGAAATGGTGAAATGAAATGAGG + Intergenic
1025891235 7:65652466-65652488 TGAAATGGTGAAATGAAATGAGG + Intergenic
1026028025 7:66762750-66762772 GGACATGGAGAAATGGCATTGGG + Intronic
1026443952 7:70467921-70467943 TTGCTTGGTGAAATGTCAGTGGG + Intronic
1026483839 7:70800971-70800993 TGACATGGGGCAGTGTCATGGGG - Intergenic
1027355757 7:77353239-77353261 TGAAATGATATAATGTCATTTGG - Intronic
1027716353 7:81676225-81676247 TGGCATGATGAGTTGTCATTTGG + Intergenic
1028525043 7:91774784-91774806 TGGCTTTGTGAATTGTCATTTGG - Intronic
1029009870 7:97248368-97248390 TTACCTTGTGAACTGTCATTAGG - Intergenic
1029876400 7:103757282-103757304 AGACTTGGAGATATGTCATTGGG - Intronic
1030773996 7:113511324-113511346 AGAAATGGGGAGATGTCATTGGG - Intergenic
1031401838 7:121333635-121333657 TGAAAAGGTTAAATGTAATTAGG + Intronic
1032405384 7:131652122-131652144 TGAAATGGTGACATTTCATTTGG + Intergenic
1032640567 7:133762045-133762067 TTAAATGTTTAAATGTCATTGGG + Intronic
1032687115 7:134245908-134245930 TTAAATGGTGAAATGTAAATAGG + Intronic
1034947227 7:155270251-155270273 AGACATTGTGCAATTTCATTTGG + Intergenic
1035157651 7:156927306-156927328 TGTCATGAGGAATTGTCATTTGG - Intergenic
1035920671 8:3672647-3672669 TGACATGGTGCAGTGTCACTGGG + Intronic
1037450407 8:19011154-19011176 TTACATGGGGTAATGTCATTTGG - Intronic
1038178890 8:25207699-25207721 TGACCTGGTGCATTGTCAATGGG - Intronic
1039129363 8:34245232-34245254 TTACGTTGTGAAATCTCATTTGG + Intergenic
1041794596 8:61733582-61733604 CGGCATGGTTAAATGTCATCTGG + Intergenic
1044652281 8:94508851-94508873 TGACAAGCTAAAATGCCATTAGG + Intronic
1044766395 8:95579943-95579965 TTATATGATGAAATGTTATTTGG + Intergenic
1045458173 8:102402636-102402658 GGACATGGTGGAAATTCATTTGG - Intronic
1045945075 8:107786445-107786467 TCATATGGTGACATGTCTTTGGG - Intergenic
1050668611 9:7969867-7969889 GGACATGGTCAAATGTCCCTTGG - Intergenic
1052116382 9:24652571-24652593 TGACATGGATAAAAGTCACTTGG + Intergenic
1054977419 9:71164145-71164167 TGACATGATGAATTATCTTTTGG - Intronic
1058136381 9:101312464-101312486 TGACAAGTTTAAATATCATTTGG - Intronic
1059450069 9:114365694-114365716 TTACATGTTGAAATGATATTTGG - Intronic
1059909917 9:119031594-119031616 TGTCATGGTCAAATGTATTTGGG + Intergenic
1203613709 Un_KI270749v1:31809-31831 TGAAATGGTGAAATGAAATGAGG + Intergenic
1185941745 X:4328792-4328814 TGACATGTTGAAATGAAATCAGG - Intergenic
1186438150 X:9561104-9561126 TGTCATGGTGATGGGTCATTGGG - Intronic
1186957574 X:14700190-14700212 AGACATGCTGAGAAGTCATTAGG + Intronic
1189018577 X:37310043-37310065 TGAAATGGTCAAACATCATTTGG + Intergenic
1189136354 X:38554733-38554755 TCCCAGGGTAAAATGTCATTTGG + Intronic
1189348163 X:40258167-40258189 TGACATGGTGACATTTCAGGGGG + Intergenic
1191688961 X:63920615-63920637 TGGCATGATGAAAAGTCATGAGG + Intergenic
1192078784 X:68027427-68027449 TGACAAGGTGCATTGTCAATGGG - Intergenic
1192180776 X:68914405-68914427 TGACATGAGGCAGTGTCATTTGG + Intergenic
1193585513 X:83317043-83317065 TGACATGTGTAAATGTCATTAGG - Intergenic
1194723154 X:97364211-97364233 TTAAATTGTGAAATGTCCTTGGG - Intronic
1197353896 X:125410794-125410816 TGAAATGCAGAATTGTCATTGGG + Intergenic
1198457255 X:136828773-136828795 TGACATGCTAAATTGTGATTTGG - Intergenic
1200644569 Y:5765336-5765358 TGCCATTGTGAAAAGTCAGTTGG - Intergenic
1200856789 Y:7947591-7947613 AGACATTGTAAAATATCATTTGG - Intergenic
1200862976 Y:8012761-8012783 AGACATTGTGAAATATCATTTGG - Intergenic
1202261529 Y:22975310-22975332 GGACATTGTAAAATATCATTTGG + Intronic
1202414517 Y:24609051-24609073 GGACATTGTAAAATATCATTTGG + Intronic
1202456268 Y:25061035-25061057 GGACATTGTAAAATATCATTTGG - Intronic