ID: 992374594

View in Genome Browser
Species Human (GRCh38)
Location 5:76175866-76175888
Sequence GCTGTCAGACAGATCTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992374594_992374600 9 Left 992374594 5:76175866-76175888 CCCTGTCAGATCTGTCTGACAGC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 992374600 5:76175898-76175920 ACTCTGTCAGAATCTCCGCATGG 0: 1
1: 0
2: 0
3: 7
4: 85
992374594_992374603 15 Left 992374594 5:76175866-76175888 CCCTGTCAGATCTGTCTGACAGC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 992374603 5:76175904-76175926 TCAGAATCTCCGCATGGGGATGG No data
992374594_992374602 11 Left 992374594 5:76175866-76175888 CCCTGTCAGATCTGTCTGACAGC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 992374602 5:76175900-76175922 TCTGTCAGAATCTCCGCATGGGG 0: 1
1: 0
2: 0
3: 5
4: 88
992374594_992374605 21 Left 992374594 5:76175866-76175888 CCCTGTCAGATCTGTCTGACAGC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 992374605 5:76175910-76175932 TCTCCGCATGGGGATGGGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 133
992374594_992374601 10 Left 992374594 5:76175866-76175888 CCCTGTCAGATCTGTCTGACAGC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 992374601 5:76175899-76175921 CTCTGTCAGAATCTCCGCATGGG 0: 1
1: 0
2: 0
3: 11
4: 89
992374594_992374604 16 Left 992374594 5:76175866-76175888 CCCTGTCAGATCTGTCTGACAGC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 992374604 5:76175905-76175927 CAGAATCTCCGCATGGGGATGGG 0: 1
1: 0
2: 0
3: 3
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992374594 Original CRISPR GCTGTCAGACAGATCTGACA GGG (reversed) Intronic
900791261 1:4682447-4682469 GCTGCCAGAAAGAGCTGATAGGG - Intronic
902738896 1:18420606-18420628 GCAGTGAGAGAAATCTGACATGG - Intergenic
902981459 1:20126457-20126479 GTGGTCAGACAGACCTGACATGG + Intergenic
904684886 1:32252639-32252661 GCTGACAGACGAATCAGACAGGG + Intronic
906204176 1:43978571-43978593 GCTGTCAGACAATTCGGGCATGG - Intergenic
908793494 1:67806644-67806666 AATTTCAGACAGAGCTGACAAGG + Intronic
910344419 1:86219470-86219492 GCAGTCAGACAGACCTGAGTTGG + Intergenic
911392087 1:97258229-97258251 GGGGTCAGTCAGAGCTGACATGG - Intronic
912593374 1:110849906-110849928 GCGGAGAGACAGCTCTGACATGG + Intergenic
912919002 1:113847404-113847426 GATGTCAGAATTATCTGACAAGG - Intronic
912989383 1:114469480-114469502 TCTGTCAGAGAGATGTGATATGG + Intronic
913347926 1:117826648-117826670 GCTTTCCAACAGATCTGTCAGGG - Intergenic
915552636 1:156644214-156644236 ACTGTCAGACAGAGGTGAAAGGG + Intronic
917787571 1:178475189-178475211 TCTGCCAGACAGATCTAAAATGG + Intronic
917926644 1:179794767-179794789 GCGCTCAGACAGATATTACATGG + Intronic
922202752 1:223420240-223420262 GCTGTCAGAGAGCCCTGACCTGG - Intergenic
1066108494 10:32176483-32176505 GCTGCCAGCAAGAACTGACATGG + Intergenic
1069484346 10:68811866-68811888 GATGTTAGAATGATCTGACAAGG - Intergenic
1072322500 10:94264387-94264409 GGTGTCAGACAGATGTGCAAGGG + Intronic
1075587484 10:123668081-123668103 GCAGGCAGAGAGCTCTGACAGGG + Intronic
1076920719 10:133453308-133453330 GGTGTCAGAATTATCTGACAAGG - Intergenic
1078846129 11:15119810-15119832 GCAGCCAGACAGATCTGACTTGG + Intronic
1079623860 11:22591744-22591766 TCTTTCTGACAGATGTGACAGGG + Intergenic
1080134981 11:28844091-28844113 TCTGTCAGCCACATCTGGCAAGG - Intergenic
1080512178 11:32985946-32985968 GCTGGCAGACAGCCCTCACATGG + Intronic
1081068195 11:38575483-38575505 GCTGTCAGATAGACATAACATGG - Intergenic
1083669053 11:64290439-64290461 GCCATCAGACAGACCTGCCAGGG - Intergenic
1088185448 11:107162528-107162550 GCTGTTAGATAGATCTCAAAAGG - Intergenic
1089635411 11:119808584-119808606 GCTGTCAGAAGGTGCTGACATGG + Intergenic
1091004146 11:131937347-131937369 TCTATTAGACAGATATGACAGGG + Intronic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1093190033 12:16063912-16063934 GCAGTCAGTCAAATCTGACCTGG + Intergenic
1094474971 12:30833821-30833843 ACAGTCAGAGAGATCTGCCATGG + Intergenic
1097409409 12:59232444-59232466 GCTGTCAGAACCATCTGAAAAGG - Intergenic
1097521737 12:60679138-60679160 ACTGTCTGAGAGACCTGACAAGG - Intergenic
1099778154 12:87161019-87161041 GCTGTCAGTCAGATCTGGACAGG - Intergenic
1104654354 12:130562458-130562480 GCTGTCAGGCTGAAGTGACATGG + Intronic
1104887926 12:132122306-132122328 GCTGTCCTACTGATCAGACATGG - Intronic
1107371515 13:39755347-39755369 GCTATCAGACAGATCAAATAAGG - Intronic
1108010947 13:46009340-46009362 GCTGTCAGAGAAATCTTAAAAGG - Intronic
1108700899 13:52943399-52943421 GCTGTCAGCCTGATTGGACACGG + Intergenic
1113967442 13:114162060-114162082 GCTGTCAGGAAGCTCTCACAGGG + Intergenic
1119266045 14:73263836-73263858 GCTGTCACACACACCTGTCAGGG - Intronic
1120704370 14:87732075-87732097 GCTGTTAGAAAGTTCTGATAAGG + Intergenic
1120853950 14:89196704-89196726 GCTGTGAAACAGACCTGGCAGGG - Intronic
1121137488 14:91511052-91511074 GCTGGCAGACAGTTCTGATAGGG - Intergenic
1134474759 16:14563395-14563417 CCTGCCAGCCAGATCTGTCATGG - Intronic
1135221152 16:20614937-20614959 GCTGGCTGAGAGATCTGCCAAGG + Intronic
1140087226 16:71808343-71808365 GTTATCTGACAGACCTGACACGG + Intronic
1141273826 16:82566415-82566437 GCAGTCTGACAGAGCTGACTTGG - Intergenic
1141532339 16:84655151-84655173 GATGCCAGACAGATCCGACTTGG - Intronic
1143966895 17:10762002-10762024 ACTTTCTGCCAGATCTGACATGG - Intergenic
1144859907 17:18294895-18294917 TCTGTCAAACAGAGCTGAAAAGG + Intronic
1146644599 17:34568650-34568672 GATGTCAGACAGGCCTGACCTGG + Intergenic
1149567809 17:57652226-57652248 GCAGCCACACAGATCCGACAGGG - Intronic
1152193069 17:78900203-78900225 GCTGTCAGACAGTTATGACCAGG - Intronic
1153538773 18:6133163-6133185 GCTGTCTGACAGAACTCTCAGGG + Intronic
1159624154 18:70672234-70672256 GCTGTCACACAGACATGACTGGG + Intergenic
1160077885 18:75694924-75694946 GCTGTCAGATCCAACTGACATGG - Intergenic
1160181152 18:76637948-76637970 GATGGCAGCCAGATCTGACCTGG - Intergenic
1160200477 18:76791923-76791945 GCGATCAGACAGATCCGCCAGGG + Intergenic
1160570907 18:79817055-79817077 GCTGTCATACAGCTGTCACACGG + Intergenic
1160570916 18:79817156-79817178 GCTGTCATACAGCTGTCACACGG + Intergenic
1160570925 18:79817259-79817281 GCTGTCATACAGCTGTCACACGG + Intergenic
1161808209 19:6457360-6457382 GAAGTCAGACAGATCTGGCCAGG - Intronic
1166419072 19:42620672-42620694 CCTGCCATAGAGATCTGACAGGG - Intronic
1168237982 19:55075738-55075760 GCTGGCAGACAGATCTAGGAGGG - Intronic
1168271938 19:55254836-55254858 GCTCTCAGCCAAATCTGAAAGGG + Intronic
1168558612 19:57364206-57364228 GCTCACAGACATATCTGATACGG - Exonic
925016105 2:525529-525551 GCTGTGACACAGCGCTGACAAGG + Intergenic
926147543 2:10405765-10405787 GCAGTCAGCCAGAGCTGGCAGGG - Intronic
927864329 2:26579066-26579088 GATGTCAGACAGACCTGGGACGG - Intronic
933355229 2:81201033-81201055 TCTGTCAGACACATCAGACGAGG - Intergenic
938733820 2:134167979-134168001 TTTGTCAGACAGGTGTGACAAGG - Intronic
938972210 2:136442974-136442996 TCTGTCAGGTAGATCTGAAAAGG - Intergenic
939683596 2:145169842-145169864 GATGTCAGACAGATCTAACATGG + Intergenic
939915102 2:148030882-148030904 TCTGTCAGACTTATCTAACAGGG + Intronic
940176080 2:150878866-150878888 ACTGTAAGAGAAATCTGACATGG - Intergenic
941697979 2:168573691-168573713 GCTTTCATGCAGATCTGTCATGG + Intronic
942174944 2:173324450-173324472 GCTGTAAGCCAGAACTGCCAGGG + Intergenic
945238534 2:207655140-207655162 GCTGTCTGGCAGTTCTGTCAAGG - Intergenic
946043608 2:216803365-216803387 GCTGCCAGACACATCTTACAAGG + Intergenic
946541095 2:220685370-220685392 GCTGTCACAGAGGGCTGACAAGG - Intergenic
947134236 2:226961156-226961178 GCTGTCAGTCAGGTCTGAGTTGG + Intronic
1170159277 20:13295940-13295962 GCTGTCACACGGCCCTGACATGG + Intronic
1170543420 20:17411635-17411657 CCTGTCTGACAGATCTGAAGAGG + Intronic
1171304086 20:24089766-24089788 GTTGTCTGACGGATCTGAGAAGG + Intergenic
1173099947 20:40076884-40076906 GCTGTAAGACAAATCAGGCAGGG + Intergenic
1174337320 20:49872213-49872235 CCTGTAAGACACACCTGACATGG - Intronic
1180700626 22:17779678-17779700 GCTGTGAAGCAGATCTGATAGGG + Intergenic
1180956759 22:19744737-19744759 GCTGGCAGAGGGATGTGACATGG + Intergenic
949204403 3:1420695-1420717 GCTGTTAGACAGGCTTGACATGG + Intergenic
952858206 3:37790751-37790773 GCAGTCACACAGGTCTCACATGG - Intronic
955452892 3:59089307-59089329 TTTGTCAGACAGATCTATCAAGG + Intergenic
956528078 3:70186869-70186891 GCTGTCTGACAGACATGTCATGG - Intergenic
961768683 3:129232096-129232118 ACTTCCAGATAGATCTGACAAGG + Intergenic
963782369 3:149499059-149499081 GCTGACAGACAGGGCTGACTGGG - Intronic
964409488 3:156383095-156383117 GCTCTCAGAAAGACCTGACAAGG - Intronic
966826233 3:183967271-183967293 TCTGTCAGACAGGACTGTCAGGG - Intronic
969863186 4:10053658-10053680 TGTGTCAGAAAGATGTGACATGG + Intronic
970727500 4:19063765-19063787 TCTGTGAGACAGACCTGGCAAGG - Intergenic
972555700 4:40178814-40178836 GCTGTCGGAGAGCTCTGTCAGGG + Intergenic
973537779 4:51901255-51901277 GCTGTCCCTCAGAGCTGACATGG - Intronic
974989605 4:69069258-69069280 GATAGCAGACAAATCTGACAAGG - Intronic
975476995 4:74834800-74834822 GCTGTGATGCAGATCTGACAAGG + Intergenic
975855135 4:78616487-78616509 TCTGTCAGACTGCTCTGAAATGG - Intergenic
977673369 4:99721090-99721112 GTTGTTAGAAAGATCTGAGATGG - Intergenic
978873219 4:113606004-113606026 GCTGTCAGAATTATCTGATACGG + Intronic
983646778 4:169999613-169999635 GCTGTCATCCATATCTGAAATGG + Intronic
986433062 5:7700829-7700851 TTTGTCAGACAGATCAGAAATGG + Intronic
988014944 5:25543754-25543776 GCTGTAAGACAGTTATGAGAAGG + Intergenic
989558586 5:42825532-42825554 ACTGTCAGAGAGATCAGCCATGG + Intronic
990125387 5:52510343-52510365 GCTTTCAGACAGATCCTAGATGG + Intergenic
991893653 5:71367358-71367380 GCTTTTAGATAGATCTGAAATGG + Intergenic
992374594 5:76175866-76175888 GCTGTCAGACAGATCTGACAGGG - Intronic
993216002 5:85022861-85022883 GGTGACAGACACATCTCACATGG + Intergenic
995524539 5:113039955-113039977 GGTGAGAGACAGATCTGAGATGG + Intronic
997195652 5:131977454-131977476 CCTGCCGGACAGATCTGACAGGG + Intronic
999847339 5:155498848-155498870 TCTGTCAGACAGCTCTGCCTGGG + Intergenic
1000461464 5:161525205-161525227 GGGGTCAGCCAGATCTGACCAGG - Intronic
1001270149 5:170304966-170304988 TGTGTCTGACATATCTGACATGG + Intergenic
1003192364 6:3885847-3885869 GCTGTCACAAAGACCTGCCATGG - Intergenic
1005152520 6:22768547-22768569 GATGTCAGACACTTCTGAAAAGG + Intergenic
1005602208 6:27438627-27438649 GTTTGCAGAAAGATCTGACATGG - Intergenic
1009348295 6:62644860-62644882 GCAGTAAGAGAAATCTGACATGG + Intergenic
1009453337 6:63826482-63826504 GCTGTGAGACAGAAGTGCCAGGG + Intronic
1016903180 6:149121851-149121873 GATGTCAGACAAAGCTGAAAAGG + Intergenic
1018728294 6:166630160-166630182 ACTGTCAGGCAGCTGTGACAAGG + Intronic
1021132833 7:16932039-16932061 ACTGTCAGACATAGCTGATATGG + Intergenic
1022029229 7:26476991-26477013 GCTGTTAGTCAGATTTGAAAAGG - Intergenic
1022578897 7:31527882-31527904 GTTGGCAGACAGACCTGAAAGGG + Intronic
1023554287 7:41404469-41404491 GATGTCAGACAGAAGTGAAAAGG + Intergenic
1027745035 7:82062236-82062258 ACAGTGAGACAAATCTGACATGG - Intronic
1031187902 7:118506404-118506426 GCAGTCAGACCCATCTGTCAGGG + Intergenic
1034919034 7:155064180-155064202 GCTGCCAAACACATCTGACACGG + Intergenic
1037208883 8:16361177-16361199 GCTTTAAGACAAATGTGACAGGG + Intronic
1038546494 8:28429643-28429665 GGTGTTAGAGAGATGTGACAAGG - Intronic
1038549706 8:28456458-28456480 GACATCAGACAGTTCTGACATGG - Intronic
1040886189 8:52266494-52266516 GATGGCAGGCAGATCTCACAGGG + Intronic
1044277732 8:90321895-90321917 GCTTCCAGGCAGATCAGACAAGG - Intergenic
1045830991 8:106459846-106459868 GCTGTCAGAAAGATGATACATGG + Intronic
1046021292 8:108668532-108668554 GCTGTCAGGCTTATCTCACAGGG - Intronic
1047036102 8:120939892-120939914 GGTGTCACACAGAACTGTCAAGG - Intergenic
1047628663 8:126682205-126682227 GCTGACACACAGTTCTGAAATGG - Intergenic
1048529653 8:135235805-135235827 GCAGTCAGACAGATCTGTGTTGG - Intergenic
1049713368 8:144077633-144077655 GCAGTCAGACAGATCTGCCCAGG - Intergenic
1057253567 9:93524497-93524519 GCTGTCAGAGAGGTGTGCCAAGG - Intronic
1187670492 X:21661554-21661576 GTTGATAGACAGATCTAACAGGG + Intergenic
1192814522 X:74576995-74577017 GCTAGAAGACAGATCTGACTAGG - Intergenic
1194376385 X:93138399-93138421 GCAGACAGTGAGATCTGACAAGG + Intergenic