ID: 992376410

View in Genome Browser
Species Human (GRCh38)
Location 5:76192188-76192210
Sequence AGGTATACACAGATTACTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992376406_992376410 -10 Left 992376406 5:76192175-76192197 CCCTCAGATTCTAAGGTATACAC 0: 1
1: 0
2: 0
3: 9
4: 103
Right 992376410 5:76192188-76192210 AGGTATACACAGATTACTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992376410 Original CRISPR AGGTATACACAGATTACTTG GGG Intronic
No off target data available for this crispr