ID: 992378663

View in Genome Browser
Species Human (GRCh38)
Location 5:76215867-76215889
Sequence ACAAAGGTGTTCGCTGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992378659_992378663 25 Left 992378659 5:76215819-76215841 CCACATTGCAAGTGTATTTCAAA 0: 1
1: 0
2: 3
3: 23
4: 311
Right 992378663 5:76215867-76215889 ACAAAGGTGTTCGCTGTTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992378663 Original CRISPR ACAAAGGTGTTCGCTGTTTC TGG Intronic
915899349 1:159835222-159835244 ACAAGGGGGTTCTCTGTCTCTGG - Exonic
916100997 1:161393071-161393093 ACACTGGTTTTTGCTGTTTCTGG + Intergenic
918511639 1:185318961-185318983 AGAAAAGTGTTGACTGTTTCAGG - Intergenic
919153976 1:193737312-193737334 CCAAAGGTGTTCATTTTTTCTGG - Intergenic
921039652 1:211417333-211417355 ACAAACGTGTTCTCGGGTTCTGG + Intergenic
921692810 1:218171348-218171370 ACAGGGATGTTAGCTGTTTCAGG - Intergenic
922774257 1:228207667-228207689 ACACAGGTGTTCCCTGTCCCTGG + Intronic
923035091 1:230280136-230280158 ACAAAGCCGTTCGCAGCTTCCGG + Exonic
1064820034 10:19318698-19318720 AAAAAGTTGATCACTGTTTCAGG - Intronic
1075857549 10:125642979-125643001 ACAAATGTATTCACTGTTCCAGG + Intronic
1083202257 11:61127613-61127635 ACAAATGGGGTCCCTGTTTCTGG - Exonic
1083953522 11:65970087-65970109 ACAAAGGTGTTCACTGTGATAGG - Intronic
1084318385 11:68359107-68359129 AAAAACCTGTTTGCTGTTTCAGG - Intronic
1084955826 11:72691001-72691023 CCAGAGGTGTTGGCTGTCTCTGG + Intronic
1090487341 11:127125720-127125742 ACAGAGCAGTTTGCTGTTTCAGG + Intergenic
1095536387 12:43253281-43253303 ACAAGGGTGTCTGCTGTTTGCGG - Intergenic
1101016372 12:100505025-100505047 GCAAAGTTGTTTGCTGTTCCTGG - Intronic
1105642652 13:22281460-22281482 ACCAGGGTGTTTGCTGTCTCTGG + Intergenic
1112226132 13:97542262-97542284 ACAAAGCTGTTTCCTGTCTCTGG - Intergenic
1116959269 14:50953266-50953288 ACAAAGGTGAAAGCTTTTTCTGG - Intergenic
1124336127 15:28858436-28858458 ACAACGGTGTTGGCTGGTCCTGG + Intergenic
1125973908 15:43934607-43934629 ATAATGGTGTTCACTGTGTCAGG - Intronic
1126392757 15:48177800-48177822 AGAGGGGTGTTCGCTGTCTCGGG + Intronic
1127990050 15:64107543-64107565 ACAAAAGTGCTCTCTCTTTCTGG + Intronic
1128692873 15:69738703-69738725 ACAATTGTGTTCCCTCTTTCAGG - Intergenic
1130997684 15:88912957-88912979 ACAAAGGAATCCGCTGTGTCGGG - Intronic
1133599784 16:7327973-7327995 ACAGAAGTGTTGGCTGTGTCTGG - Intronic
1135341557 16:21652825-21652847 TCATAGGTGTTAGATGTTTCTGG + Intronic
1137793452 16:51194790-51194812 ACAGAGGTGTTGGCTTTTTGAGG + Intergenic
1137856894 16:51803708-51803730 AGAGAGGAGTTCTCTGTTTCAGG - Intergenic
1137858811 16:51825256-51825278 ATAAAGGTGTTTGCTGTAACTGG - Intergenic
1141456257 16:84144716-84144738 ACAACGGGGTTCGCGGTTTGGGG + Intronic
1141655579 16:85414401-85414423 GAAAGGGTGTGCGCTGTTTCAGG - Intergenic
1142165724 16:88586578-88586600 AAGACGGTGTTCTCTGTTTCAGG + Exonic
1148027693 17:44599977-44599999 ACACTGGTGTTCCCTATTTCAGG + Intergenic
1150705182 17:67480306-67480328 ACAAAGATGTTCCCTCTTTCTGG - Intronic
1153788909 18:8559890-8559912 ACAAAGATCTTTGCTCTTTCTGG - Intergenic
1157331372 18:46706296-46706318 ACAAAGGTGTTTGATATTTTGGG - Intronic
1158104657 18:53871901-53871923 ACAAAGGCGTTTGCTGATCCAGG - Intergenic
1159714815 18:71808589-71808611 ACAAAGGAGTTGGCAGTCTCAGG + Intergenic
1165643465 19:37410608-37410630 ACAAAGCTTTTCTTTGTTTCTGG - Intergenic
928797717 2:35042661-35042683 ACAAAAATTTTCTCTGTTTCCGG + Intergenic
935127448 2:100237003-100237025 ACAAAGATGTTCTTTGTTTAAGG + Intergenic
935617948 2:105104692-105104714 ACAGATGTGTGCGTTGTTTCTGG + Intergenic
942503086 2:176612509-176612531 AAAAATGTGGTCTCTGTTTCAGG + Intergenic
946472715 2:219977499-219977521 CCAAAGATGTTAGCTGTCTCAGG + Intergenic
947295141 2:228622196-228622218 ACAAAGGAGTTCCCTGTACCAGG - Intergenic
1168924471 20:1567774-1567796 ACTAAGGTGTTAGCTGTTGCTGG + Intronic
1169419492 20:5448568-5448590 ACTTAGGTGTCTGCTGTTTCTGG + Intergenic
1170198031 20:13711127-13711149 ACAAAGTTGTTTGCAGTTTTTGG - Intergenic
1171479336 20:25441126-25441148 ACAAAGGTGTTCCCAGGTACAGG - Intronic
1181806853 22:25380085-25380107 AAAAACCTGTTTGCTGTTTCAGG + Intronic
949192371 3:1265811-1265833 ACAAAGGTTTTTTGTGTTTCAGG - Intronic
952876945 3:37954003-37954025 AGAAATGTGTGTGCTGTTTCTGG + Intronic
955367049 3:58319766-58319788 ACAAAAGTGTTGGCTGTGTTGGG - Intergenic
956563490 3:70611235-70611257 ACTCAGGAGTTCGCAGTTTCTGG - Intergenic
959490485 3:106981753-106981775 ACAATGGTTTAAGCTGTTTCTGG - Intergenic
967896332 3:194398784-194398806 TTGAAGGTGTTCGCTGTTTTGGG - Intergenic
971821685 4:31565541-31565563 AAAAAGGTGTTCTCTATTTCAGG - Intergenic
972418474 4:38865543-38865565 GCAAAGGTGCTTGCTGTCTCTGG + Intergenic
976777799 4:88725050-88725072 ACAAAGCTGTTAGCAGTTTATGG + Intergenic
976965874 4:91040423-91040445 ACAAAAATATTAGCTGTTTCTGG - Intronic
978724796 4:111957332-111957354 GCAAAGATGTTCGCTGATGCAGG - Intergenic
979305147 4:119133884-119133906 ACAAAGGTGGTGGCTATTTGTGG - Intergenic
984419779 4:179506183-179506205 ATAAAGTTGTTCTCTATTTCTGG + Intergenic
984979435 4:185264510-185264532 ACAAACGTGTTCTCGGGTTCTGG + Exonic
987128002 5:14833369-14833391 ACAAGGGTGTTCGCTATTCATGG + Intronic
987607363 5:20154545-20154567 AAAATGGTGTTGGCTGTATCTGG + Intronic
991595361 5:68299126-68299148 ACAAAGGTGAGCGCTGTTCCAGG - Exonic
992377673 5:76204772-76204794 ACACTGATGTACGCTGTTTCAGG - Intronic
992378663 5:76215867-76215889 ACAAAGGTGTTCGCTGTTTCTGG + Intronic
993228678 5:85204112-85204134 GCAAAGGTGTTCCTTGTTGCTGG + Intergenic
994215308 5:97131135-97131157 ACCAAGGTGTTCCATGTTGCTGG - Intronic
997163301 5:131632253-131632275 ACAAAGCTGCTTGCTATTTCTGG + Intronic
999001615 5:147929955-147929977 ACAAAGGTGGACGGTGGTTCTGG - Intergenic
1003435962 6:6088311-6088333 GCAAGGGAGTTTGCTGTTTCAGG + Intergenic
1004553989 6:16677616-16677638 ACAAATGTGTCAGCTTTTTCTGG - Intronic
1014767946 6:125428666-125428688 ATAAAGGTGTTCATTGTTTAAGG + Intergenic
1014873876 6:126631402-126631424 ACAAGGGAGTTTGCTTTTTCTGG + Intergenic
1015905128 6:138108400-138108422 ACAAAGGAGTTCTCAGTGTCAGG + Intergenic
1017988028 6:159461519-159461541 ACAGAGGTGTTCACTGTATTGGG - Intergenic
1022088258 7:27089482-27089504 AAAAATGTGTTTGCTTTTTCTGG - Intergenic
1038784844 8:30602767-30602789 AAAAAGGTGTTCACTGAATCTGG + Intronic
1044814401 8:96096506-96096528 CCAAAGATATTCTCTGTTTCTGG - Intergenic
1048974684 8:139664586-139664608 ACAAAGGTGACGGCAGTTTCTGG - Intronic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1050735599 9:8759009-8759031 ACAAAGGTGTTCTTTGGTTTTGG + Intronic
1050766162 9:9137112-9137134 AAAAATGTTTTCACTGTTTCTGG + Intronic
1053411064 9:37916469-37916491 ACAAAGGGGGCCGCTGGTTCTGG + Intronic