ID: 992381693

View in Genome Browser
Species Human (GRCh38)
Location 5:76243789-76243811
Sequence CACCCAAGGAGGGCCCGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992381693_992381699 -5 Left 992381693 5:76243789-76243811 CCTGGCCGGGCCCTCCTTGGGTG 0: 1
1: 0
2: 1
3: 20
4: 198
Right 992381699 5:76243807-76243829 GGGTGTGCCCAATCAGGTCCTGG 0: 1
1: 0
2: 1
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992381693 Original CRISPR CACCCAAGGAGGGCCCGGCC AGG (reversed) Intronic
900248860 1:1655299-1655321 GACCCTAGGAAGGACCGGCCAGG + Intronic
900289236 1:1916890-1916912 CACTCAAGTAGGGCCCGGGTTGG + Exonic
900367409 1:2316844-2316866 CTCCCAGGGAAGGCCAGGCCAGG + Intergenic
900379144 1:2375284-2375306 CACCCAGGGAGGGCCGGGCAGGG - Intronic
900466180 1:2826600-2826622 CCCCTCAGGAGGGCCAGGCCTGG - Intergenic
900896546 1:5486909-5486931 AACCCACGGAGGGTCAGGCCAGG + Intergenic
902277484 1:15350163-15350185 CACCCACCGTGGGCCAGGCCCGG + Intronic
904641920 1:31937861-31937883 CCCGGAAGGAGGGCCGGGCCGGG - Intronic
904813045 1:33176347-33176369 CACCCAAGGAGGGAGGGGGCTGG - Intronic
906526741 1:46497987-46498009 AGCCCAGGCAGGGCCCGGCCTGG + Intergenic
907046849 1:51304867-51304889 CACCCTGGGAGGGCCAGGCAGGG + Intronic
907326251 1:53640431-53640453 GACCCAGGGAGGGACAGGCCAGG - Intronic
912443602 1:109716642-109716664 CACCAAAGGAAGGCCAGACCAGG - Intronic
919803891 1:201369435-201369457 CTCCTAAGGAGGGCCCAGCATGG + Intronic
922504848 1:226120588-226120610 CACCCAAGGTGTGCCAGGCACGG - Intergenic
1063045442 10:2387477-2387499 CATCCAGGGAGGGCAAGGCCTGG - Intergenic
1063449389 10:6141191-6141213 AAACCAAGGATTGCCCGGCCAGG - Intergenic
1064048719 10:12042520-12042542 CCCCCAAGCATGGCCCGGCCCGG + Intronic
1065240029 10:23695389-23695411 CCCCCCAGGAGGGCCAGGCCGGG + Intronic
1069686493 10:70322407-70322429 CAGGCAAGAAGGGCCTGGCCAGG + Intronic
1069859621 10:71462219-71462241 CACACAAGGCGGGGCCGGGCAGG - Intronic
1072803924 10:98412291-98412313 AAGCCAAGGAGGGCTCAGCCAGG - Intronic
1075078574 10:119368040-119368062 AAGCCACGGAGGGCCGGGCCAGG - Intronic
1075333665 10:121593739-121593761 AACTGAAGGAGGGCCGGGCCAGG + Exonic
1075732919 10:124646952-124646974 TACCCAGGAATGGCCCGGCCAGG - Intronic
1076546628 10:131249721-131249743 TACCCATGGAGCGCCCAGCCAGG - Intronic
1076730990 10:132438789-132438811 CCACCCAGGAGGGCCAGGCCAGG + Intergenic
1076835023 10:133016679-133016701 CATCCAGGGCGGGCCCAGCCAGG + Intergenic
1077115489 11:882831-882853 CAACCCAGGAGGCCCCGGCCCGG + Intronic
1077205941 11:1344299-1344321 CGCCCAAGGAGGAGCCGCCCAGG - Intergenic
1077307555 11:1874852-1874874 TAACCAAGGGGGGCCCTGCCGGG - Intronic
1077479615 11:2807558-2807580 GGCCCGAGGAGGGCCCGGCCCGG - Intronic
1077879142 11:6334252-6334274 CAACCAAGGAGGGTGCAGCCAGG - Intergenic
1080005218 11:27399205-27399227 GAAACAAGGAGGGCCAGGCCTGG - Intronic
1084085638 11:66853887-66853909 CTCCCCAGGAGGCCCCGTCCCGG + Intronic
1084153820 11:67303279-67303301 CTCCCAGGAAGCGCCCGGCCCGG - Intergenic
1088795594 11:113264606-113264628 CATCCTAGGAGGGCCCAGCTTGG + Intronic
1089739688 11:120573845-120573867 GACCCAAGGAGAGCCTGGCTTGG - Intronic
1090245699 11:125214565-125214587 CACCCAGGCAGGGCCAGCCCAGG - Intronic
1094228570 12:28076292-28076314 TAACCAAGGAGGGCCAGGCCCGG + Intergenic
1095960733 12:47832879-47832901 CACCAGAGGAGGGCCCTGCTGGG + Intronic
1096692231 12:53328298-53328320 CACCCATGGAGAACCAGGCCCGG - Exonic
1101037217 12:100717442-100717464 CGCCCCTGGACGGCCCGGCCCGG - Intergenic
1101940950 12:109098439-109098461 CAGCCAAGAAGGCCCCGGCTGGG + Exonic
1103479619 12:121242519-121242541 CACCCAAGGCGGGGCTGCCCAGG + Intronic
1104255202 12:127130123-127130145 CAACCAAGGATGGCCAGTCCTGG + Intergenic
1104602108 12:130161464-130161486 CAGCCAAGGAGGGCGCTGGCCGG + Intergenic
1104979098 12:132565141-132565163 CTACCAGGGAGGGGCCGGCCAGG - Intronic
1105428311 13:20314828-20314850 GACCCTAGGAGGTCCCAGCCTGG - Intergenic
1105437786 13:20391885-20391907 CAGCCAAGGAGGCCTCGGGCTGG - Intergenic
1113034721 13:106036832-106036854 CACCCAAGGAAGGCAAGGGCAGG + Intergenic
1117249523 14:53922608-53922630 CAACTAAGGAGGGCCCGGGATGG + Intergenic
1117400120 14:55351466-55351488 CTCCTAAGGAGGACCAGGCCTGG + Exonic
1118461705 14:65993346-65993368 CACCAAAGGAGGGCACGCCCAGG + Intronic
1119155433 14:72405782-72405804 CACCAAAGAAGGCCCCTGCCAGG - Intronic
1119719942 14:76883778-76883800 CACCCATGGAGGGCCTTGGCAGG - Intergenic
1121491304 14:94363366-94363388 CACCCAGAGAGAGCCAGGCCAGG - Intergenic
1121492679 14:94371413-94371435 CACCGCAGGAGGGCCCACCCCGG - Intergenic
1121664865 14:95664838-95664860 CAGCCAAGGTGGGCCAAGCCAGG - Intergenic
1122120226 14:99549343-99549365 CACCCAAGGAGGTCACTGCTGGG - Intronic
1122267001 14:100551226-100551248 CACCCTAGCAGGGCCGGGCCGGG - Intronic
1124203247 15:27696555-27696577 CACGCAGGAAGGGACCGGCCAGG + Intergenic
1125754892 15:42056956-42056978 CCCCCAAGGCCGGCCCTGCCAGG - Intergenic
1129239352 15:74242451-74242473 CACCCAACCAGGGCCTGCCCTGG + Intronic
1129675838 15:77632214-77632236 AACCCCAGGAGGGCGCAGCCAGG + Intronic
1129826892 15:78640418-78640440 CACCCGAGGTGTGCCGGGCCTGG - Intronic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132592319 16:731402-731424 CCCGCCAGGAGGGCCCTGCCTGG + Intronic
1132610583 16:813896-813918 CACCCAACGCTGGCCCAGCCCGG + Intergenic
1132793777 16:1708202-1708224 CACCCCAGAAGTGCCCAGCCAGG + Intronic
1136736483 16:32471967-32471989 CTCCAAAGGAGGGGCAGGCCTGG - Intergenic
1137725425 16:50653555-50653577 CAGCCAAGGTGAGCCGGGCCTGG - Intergenic
1139251330 16:65499299-65499321 CACCCAAGGATTGCACTGCCTGG + Intergenic
1139852517 16:69959667-69959689 CACCCAGGGAGGCTCCTGCCCGG + Intronic
1139881488 16:70182575-70182597 CACCCAGGGAGGCTCCTGCCCGG + Intronic
1141412616 16:83845678-83845700 CACACAAGGAGGTTCAGGCCGGG + Intergenic
1141573461 16:84948641-84948663 CACCCAAAGCCCGCCCGGCCGGG + Intergenic
1141573467 16:84948654-84948676 CACCGTGGGAGTGCCCGGCCGGG - Intergenic
1141662156 16:85447155-85447177 CAGGCAAGGTGGGCCCGGCATGG - Intergenic
1142291793 16:89196454-89196476 CTCCCACAGAGGGGCCGGCCTGG - Intronic
1203016587 16_KI270728v1_random:357611-357633 CTCCAAAGGAGGGGCAGGCCTGG + Intergenic
1203034922 16_KI270728v1_random:630769-630791 CTCCAAAGGAGGGGCAGGCCTGG + Intergenic
1142608602 17:1095953-1095975 CACCCCAGGAGGGCCAGTCGTGG + Intronic
1143527349 17:7480043-7480065 CACTCAAAGAGGGCCAGCCCTGG + Intronic
1144787507 17:17840205-17840227 CAGCCAATGGGCGCCCGGCCCGG + Intergenic
1145057873 17:19715033-19715055 CACCCAAGACGGGCCCACCCGGG + Intronic
1146656376 17:34637488-34637510 CAGCCAACCAGGGCCCGGCGGGG + Exonic
1147357814 17:39911367-39911389 CACTCAAGGAGAGCAAGGCCAGG + Intronic
1147777525 17:42913091-42913113 CAGGCAAGGAGGGCCCGGTGCGG - Exonic
1150296217 17:64008984-64009006 CAGCCAAGCAGGGCCTGCCCAGG - Intronic
1150690887 17:67366247-67366269 GACCCCAGGTCGGCCCGGCCAGG - Intronic
1152224346 17:79085804-79085826 AACCCAAGAAGGGGGCGGCCTGG - Intronic
1152310735 17:79548225-79548247 CCACCCAGGAGGGCCCAGCCTGG + Intergenic
1152318821 17:79596520-79596542 CACCCACCGTGGGCCCAGCCAGG + Intergenic
1152347278 17:79760835-79760857 AACCCTTGGAGGGCCAGGCCAGG + Intergenic
1152610213 17:81311664-81311686 CATCCAAGGACGGACAGGCCTGG - Exonic
1152722596 17:81930176-81930198 CACCCTGGGAGGGCCCTGCCTGG - Intergenic
1152793143 17:82292980-82293002 AGACCCAGGAGGGCCCGGCCAGG + Intergenic
1152830898 17:82496575-82496597 CACGGAAGGAGGGCACGCCCAGG + Intergenic
1155221640 18:23690298-23690320 CACCCACGGAGCGTCCCGCCAGG + Intronic
1160299533 18:77667615-77667637 CACCCAAGGAGGGTCCTGCCAGG - Intergenic
1160536050 18:79592949-79592971 CACCCAGGGAGGGACCTGCTGGG - Intergenic
1160575940 18:79853846-79853868 CACTCAAGTAGTGCCCGCCCTGG - Intergenic
1160909968 19:1469819-1469841 CGCCCGAGGACGCCCCGGCCGGG + Exonic
1160981300 19:1817797-1817819 CACACAGTCAGGGCCCGGCCAGG + Intronic
1161194976 19:2981606-2981628 CAACCAAGGAGGGCCCCACTGGG + Intronic
1161314930 19:3613316-3613338 CCTCCGAGGAGGGCCCGGGCGGG + Exonic
1161399243 19:4060144-4060166 CAGCCCAGGAGGGGCCTGCCAGG - Intronic
1161845031 19:6707406-6707428 CACCCCAGGAGACCCCAGCCCGG - Intronic
1162793934 19:13077087-13077109 CACCTACTGAGGCCCCGGCCAGG - Intronic
1162901010 19:13795605-13795627 CCCCCAAAGAGGCCCCGCCCCGG + Exonic
1163155971 19:15440120-15440142 CACACAGGTAGGGCCCGGTCCGG + Intronic
1163713529 19:18861055-18861077 CCCCCAAGAGGGGCCCGTCCTGG + Intronic
1163836199 19:19575837-19575859 CACCCATGGAGGTCGCGGCCAGG + Intronic
1163883300 19:19945694-19945716 CTCCCAAGGAGGCTCCTGCCAGG - Intergenic
1164179758 19:22807829-22807851 CCCGCTAGGAGGGCCCGTCCTGG - Intergenic
1166366294 19:42280186-42280208 CTCCCCACGAGGGCCCGGGCAGG + Intronic
1166751346 19:45165250-45165272 CACCCAGGGGGGGACCTGCCAGG + Intronic
1166960813 19:46494978-46495000 AACCCAAGGAGGGGCCGTCGGGG - Exonic
1167255807 19:48427956-48427978 CAGCCAAGGAGAGGCAGGCCTGG - Intronic
1167278911 19:48554881-48554903 CTGCCAAGCAGGGCACGGCCAGG + Intronic
1168536423 19:57174101-57174123 CACCTGAGGTGGGCCCGGCGTGG - Intergenic
927519696 2:23691282-23691304 CACCCAAGGCAGGCAGGGCCGGG + Intronic
927719826 2:25375511-25375533 CACACAAGGAGAACCCGTCCGGG + Intergenic
929602027 2:43210495-43210517 CACCAAAGGAGAGCCCAGCCAGG - Intergenic
931877156 2:66526383-66526405 CACCCATGGCAGGCCGGGCCTGG + Intronic
932190998 2:69741755-69741777 CACCCTCGGAGGGCCGAGCCCGG - Intronic
936258156 2:110934967-110934989 TAGCTAAGGAGGGCCCTGCCAGG + Intronic
937258775 2:120572418-120572440 GACCCAAGAAGGGCCTGGCACGG + Intergenic
938343363 2:130549656-130549678 CCCGCCAGGAGGGCCCAGCCAGG - Intronic
938346470 2:130571066-130571088 CCCGCCAGGAGGGCCCAGCCAGG + Intronic
947623193 2:231604081-231604103 CACCCAGGGGTGGCCTGGCCTGG + Intergenic
947660710 2:231864654-231864676 AACCCAAAGAGGGCCGGGCTTGG - Intergenic
947711585 2:232319494-232319516 CACCCCAGGAGGGCCCTGTGTGG - Intronic
948150144 2:235738415-235738437 CAGCCAGGGAGGGCTCGGCAGGG + Intronic
948423027 2:237872184-237872206 CAGCCAAGGAGGGCCTGGCACGG + Intronic
949035040 2:241812346-241812368 CCCCCAAGGAGGGCCCTGTCAGG + Intronic
1170898867 20:20440727-20440749 CTGCCAAGGAAGGCCCGGGCCGG - Intronic
1172105497 20:32514933-32514955 CACCCAACGAAGGGCCGACCGGG - Intronic
1173852693 20:46228752-46228774 CAGCCCAGGAGGGGCCTGCCTGG - Intronic
1174393331 20:50231562-50231584 CCCCCAGGGAGGACCTGGCCTGG + Intergenic
1175783483 20:61697994-61698016 CAGCCAAGGAATGGCCGGCCAGG - Intronic
1176086482 20:63297610-63297632 CACCCAGGGAGGCCCCAGCCTGG - Intronic
1177148357 21:17430269-17430291 CACCCAAGCAGGCCACAGCCTGG + Intergenic
1178983739 21:37285768-37285790 CACCCTAGGAAGGCCAGGGCTGG - Intergenic
1179788872 21:43744155-43744177 CACCCAGGCAGGGCCAGGCTAGG + Intronic
1180225644 21:46390541-46390563 CACCCAGGCAGGGCCAGGCCAGG - Intronic
1181277358 22:21695231-21695253 CACCCACAGAGGCCCCGGCCAGG - Intronic
1181442055 22:22941807-22941829 CACCCCAGGAGAGCCAGGCTGGG - Intergenic
1183651057 22:39153299-39153321 CCGCGAACGAGGGCCCGGCCCGG - Intergenic
1183676430 22:39301447-39301469 GACCCAAGGAGGTCCCCGCTTGG + Intergenic
1183731871 22:39622739-39622761 CACTCAAGGAGGACCTGGACTGG - Intronic
1184155112 22:42662307-42662329 GACCCAAGGTGGGCACGGGCTGG - Intergenic
1185076970 22:48688594-48688616 AACCCAGGGAGGAGCCGGCCAGG - Intronic
1185299150 22:50070451-50070473 CACCAAGGGAGGGCTAGGCCAGG + Intronic
951611451 3:24495510-24495532 AACCCTGGGAGGGCACGGCCGGG - Intergenic
956678086 3:71753894-71753916 GAGCCCAGGAGGGGCCGGCCGGG + Intronic
968546775 4:1202910-1202932 CGGCCAAGGAGGGCTGGGCCAGG + Intronic
968576241 4:1367566-1367588 CGCCCAGGGAGGGCCCAGGCTGG + Intronic
968625132 4:1623551-1623573 CACCGCAGGAGGGGCCGGCCAGG - Intronic
969259350 4:6023705-6023727 CAGCTGAGGATGGCCCGGCCTGG + Intergenic
969396993 4:6928308-6928330 CCCCCAAGGAGCTCCCAGCCAGG - Intronic
969431934 4:7160486-7160508 GCCCCAAGGCGGGCCTGGCCGGG - Intergenic
969927336 4:10597250-10597272 CACCCCAGGAAGGCTTGGCCAGG + Intronic
976825910 4:89260095-89260117 GACCCAAGTAGGGCCAGGCGTGG - Intronic
984767229 4:183408931-183408953 CAGCCATGGAGGGCAGGGCCAGG + Intergenic
985242330 4:187943663-187943685 ATCCCAAGGAGGGCCGGGCGTGG - Intergenic
992381693 5:76243789-76243811 CACCCAAGGAGGGCCCGGCCAGG - Intronic
993017793 5:82555238-82555260 CAGACAAGGAGGGCCAGGCATGG - Intergenic
999247352 5:150162248-150162270 CACCCCAGGAGGCCCTGGCTGGG + Intergenic
999251228 5:150183584-150183606 CCCCCAGGGATGGCCCGGCTGGG - Exonic
999311081 5:150552652-150552674 AACCCAAGGCGGGCAGGGCCAGG - Intronic
999747261 5:154601754-154601776 CAGTCAAGGAGGGCCTGGCTAGG - Intergenic
1001956281 5:175850260-175850282 CACCCATGCAGGGCCCAGCAAGG + Intronic
1002605349 5:180379859-180379881 CACCCACTGTGGGCCCGGCACGG - Intergenic
1006116196 6:31777290-31777312 CAGCCAAGGGAGGCCCGCCCTGG - Exonic
1007168211 6:39843471-39843493 CACACAAGGAGTGGCCAGCCAGG + Intronic
1013599137 6:111687954-111687976 CTCCCAAAGAGGGCAGGGCCTGG - Intronic
1015275239 6:131377328-131377350 CCCCCAGGGAGGTCCAGGCCAGG - Intergenic
1015315071 6:131808091-131808113 CTCCCCGGGAGGGCCCGGCGGGG + Exonic
1015773698 6:136792898-136792920 CCCCCAAGGAGGGCGCTGCTAGG + Intergenic
1018464207 6:164028414-164028436 AACCCAATGGGGGCCCGGCGTGG - Intergenic
1019347471 7:538068-538090 AACCTAAGCAGGGCCTGGCCGGG - Intergenic
1020683019 7:11259923-11259945 CAGCCAAGGAGGGGCCAGACTGG - Intergenic
1026907064 7:74068803-74068825 CACCCCAGGAGGGAACGGGCAGG + Intronic
1026953029 7:74360147-74360169 CCCCCAAGGAAGGCCAGGACAGG - Intronic
1028976393 7:96919056-96919078 TACCCAAGTAGGGCCGGGCGCGG - Intergenic
1030070651 7:105694769-105694791 GAAGCAAGGAGGGCCGGGCCAGG - Intronic
1031052001 7:116953931-116953953 CCCGCAAGGCGGGCCGGGCCGGG + Exonic
1032194120 7:129780000-129780022 CACCCAGGAAGCGCGCGGCCGGG - Intergenic
1035307562 7:157943021-157943043 CACAGCAGGAGGGCCGGGCCTGG + Intronic
1035519541 8:266078-266100 CACCTGAGGAGGGGGCGGCCAGG + Intergenic
1036664297 8:10729101-10729123 AACCGCAGGAGGGCTCGGCCTGG + Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1039885476 8:41651697-41651719 CACCGACGGAGTGCCCGGCACGG - Intergenic
1040308410 8:46224076-46224098 CACCCAGGGCTGTCCCGGCCTGG + Intergenic
1042231597 8:66560975-66560997 CATACAAAGAGGGCCCGGCGCGG + Intergenic
1047186139 8:122635045-122635067 CACCCCAGGAGAACCCTGCCTGG + Intergenic
1049193019 8:141299194-141299216 AAGCCAAGGAGGGCCCAGCCCGG + Intronic
1049385582 8:142341445-142341467 CATCCCAGGAGGGCCCTGGCAGG + Intronic
1049658177 8:143808043-143808065 CACCTCAGGAGGGCCCGACAAGG + Intronic
1049742820 8:144249178-144249200 CACCCGAGGAGGGCTGGGCAGGG - Intronic
1049842554 8:144782545-144782567 AACTCAAGGAGGGCCGGGCACGG + Intronic
1050203730 9:3176214-3176236 GAACCAAGGAGGGCTTGGCCAGG - Intergenic
1054881404 9:70148602-70148624 CACCTAGGGAGGGCCAGGCATGG + Intronic
1055785104 9:79863349-79863371 CACCTAAGCAGGTCCCAGCCAGG + Intergenic
1057605847 9:96497177-96497199 CAGGTAAGGAGGCCCCGGCCTGG - Intronic
1058467592 9:105244768-105244790 CGCCCGGGGAGGGCGCGGCCTGG - Exonic
1060943329 9:127555938-127555960 CACCCACTGAGGGCCCACCCAGG - Intronic
1061320104 9:129823435-129823457 CATCCCAGGAGGGCCGGGCCTGG - Intronic
1061372148 9:130203483-130203505 CTCCCAAGGAGGGCCAGGGCAGG + Intronic
1062079920 9:134618395-134618417 AAGCCAAGGAGGTTCCGGCCCGG - Intergenic
1062400799 9:136371785-136371807 AACCCCAGGAGAGCCCCGCCTGG - Intronic
1062414887 9:136443318-136443340 CAGCCGGGGAGGGCCCAGCCTGG + Intronic
1062547573 9:137070509-137070531 GCCCCACGGAGGGGCCGGCCCGG + Exonic
1062638008 9:137501563-137501585 CACCAGAGGAGGGCCTGGACTGG - Intronic
1185833289 X:3321519-3321541 CCCTCAAGGACGGCCCAGCCTGG - Exonic
1190218447 X:48495488-48495510 CACCCCAGGTGGTCCTGGCCAGG + Intergenic
1195915016 X:109927554-109927576 CACCCAGGAAGGGCAAGGCCTGG + Intergenic
1200112230 X:153746813-153746835 CTCCAAAGGAGGGGCAGGCCTGG + Intergenic