ID: 992381856

View in Genome Browser
Species Human (GRCh38)
Location 5:76245322-76245344
Sequence ATGGAGAAACAGGCTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992381848_992381856 22 Left 992381848 5:76245277-76245299 CCAAGACTTGGAGGAAGAGGAAG 0: 1
1: 0
2: 3
3: 60
4: 587
Right 992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992381856 Original CRISPR ATGGAGAAACAGGCTGTGGA AGG Intronic
No off target data available for this crispr