ID: 992390967

View in Genome Browser
Species Human (GRCh38)
Location 5:76330677-76330699
Sequence CTTGATTACCTGGTTTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992390964_992390967 0 Left 992390964 5:76330654-76330676 CCTTTGATGAGAGGAGAAAGCTC 0: 1
1: 0
2: 0
3: 11
4: 235
Right 992390967 5:76330677-76330699 CTTGATTACCTGGTTTTTGTTGG 0: 1
1: 0
2: 1
3: 13
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992390967 Original CRISPR CTTGATTACCTGGTTTTTGT TGG Intronic
900504760 1:3024174-3024196 TTAGAGTACCTCGTTTTTGTAGG + Intergenic
900904692 1:5546516-5546538 CTTCATTATTTGGTCTTTGTAGG - Intergenic
903547598 1:24136459-24136481 CCTGATGACCTGATTTCTGTAGG - Intronic
903612951 1:24630145-24630167 CTTTCCTACCTAGTTTTTGTGGG + Intergenic
904874689 1:33644971-33644993 CTTGATTATCTCCTGTTTGTCGG - Intronic
905494591 1:38374954-38374976 CTTGTTTACCTGGTTATTTTGGG + Intergenic
907217830 1:52880918-52880940 TATGATTCCCTGGTTTCTGTGGG - Intronic
910836162 1:91513917-91513939 CTTATTTTCCTTGTTTTTGTTGG + Intronic
915692619 1:157704754-157704776 CATGATTACATAGTTATTGTAGG + Intergenic
916844899 1:168640505-168640527 CTTTAACACCTGGTTTTTGAGGG + Intergenic
918137830 1:181691449-181691471 CTTAATTATCTGATTTCTGTAGG - Intronic
918395145 1:184106481-184106503 CTTGATTAGCTTTTTTTTGATGG + Intergenic
918795643 1:188891676-188891698 TTTGAATACCTATTTTTTGTGGG - Intergenic
919125450 1:193387353-193387375 CTTGAATACCTGTTATTTTTTGG + Intergenic
919399218 1:197088336-197088358 CTTTATTACCAGGCTTTTCTCGG + Exonic
920151541 1:203912862-203912884 CTTGACTACGTGGTTTTTCTAGG - Intergenic
920339447 1:205266851-205266873 TGTGATTACCCGCTTTTTGTCGG + Intronic
923137735 1:231133337-231133359 CATGCTCACCTGGTTGTTGTGGG - Intergenic
924145651 1:241072274-241072296 CTTGCCTACATGGCTTTTGTGGG - Intronic
1062807485 10:434802-434824 CTTGCTTTCGTGGTTTTTGAGGG + Intronic
1064478150 10:15713783-15713805 CTGGATGACAAGGTTTTTGTTGG - Intronic
1068364862 10:56034844-56034866 CTTGATGTCCTTGTTTTTGGAGG + Intergenic
1071923264 10:90375286-90375308 CTTGAAGAACTGATTTTTGTAGG + Intergenic
1073121824 10:101126667-101126689 CTTAATTACTTTGTGTTTGTGGG - Intronic
1075405822 10:122195163-122195185 CTTGGTTACCTGGTTCTTCCGGG - Exonic
1075561319 10:123470596-123470618 TTGGATTTCCTGGGTTTTGTTGG + Intergenic
1075592647 10:123703699-123703721 CTTGATTCACTTCTTTTTGTTGG + Intergenic
1076486419 10:130821753-130821775 TTTGTTTATTTGGTTTTTGTTGG - Intergenic
1076987641 11:250687-250709 TCTGCTTAGCTGGTTTTTGTTGG + Intronic
1079884027 11:25963877-25963899 CTTGGTTACATGATTTTTTTAGG - Intergenic
1081380123 11:42404448-42404470 CTTTATTAACTGGCTTTTATGGG + Intergenic
1081693357 11:45093198-45093220 CTTGCTTTCCTGGTTTTCCTTGG - Intergenic
1085094431 11:73747934-73747956 CTTGATCACTTGGTTATTGGTGG + Intronic
1085979414 11:81705524-81705546 CTTGTTTTCCAGGTTTTTGGGGG + Intergenic
1087615973 11:100486952-100486974 TTTGATTAACTAGTTTTTGCTGG - Intergenic
1091696962 12:2634069-2634091 CTGGATAACCTGGTTTTCGCAGG - Intronic
1092655480 12:10679829-10679851 CTTGTTTCTTTGGTTTTTGTGGG - Intergenic
1097153890 12:56998654-56998676 CTTGTTGACCTGTTTTTAGTGGG - Intergenic
1098002350 12:65958744-65958766 CTAGATTACCAAGTATTTGTAGG + Intronic
1099685751 12:85886314-85886336 CTTGCTAACCTGGTTTCTGAGGG - Intergenic
1104316576 12:127708753-127708775 TTTCCTTATCTGGTTTTTGTAGG - Intergenic
1107601608 13:42019727-42019749 CTTTATTACATGCTTTTTGAGGG + Intergenic
1110713553 13:78676190-78676212 TTTGATTCCCTGGTTTCTGTAGG + Intergenic
1113538952 13:111092039-111092061 CTCATTTACCTGGCTTTTGTGGG - Intergenic
1114382166 14:22218602-22218624 CTTGATTACATTGTGTCTGTTGG - Intergenic
1116547268 14:46184272-46184294 CTTTATTACATTGTTTTTGTGGG - Intergenic
1116970905 14:51065023-51065045 CTTGATTCCCTAGGTTTTGAAGG - Intronic
1118922567 14:70163236-70163258 TCTGAGTACCAGGTTTTTGTTGG - Intronic
1119315314 14:73689407-73689429 CTCGAAGACCTGGTGTTTGTAGG + Exonic
1122121478 14:99555845-99555867 CTTGATTACGTGGTTTGGGAGGG - Intronic
1123803430 15:23845851-23845873 GTTGATTATCTGGATTCTGTTGG - Intergenic
1124692612 15:31838458-31838480 CTTGGAGACCTGGTCTTTGTGGG - Intronic
1125292081 15:38161035-38161057 ATTGATTGCCTGGTTTTTGTAGG + Intergenic
1125441956 15:39712395-39712417 ACTTATAACCTGGTTTTTGTAGG - Intronic
1125547978 15:40522345-40522367 CTTGATTACCACGGTTTTATAGG + Intergenic
1126678542 15:51182760-51182782 CCTGAGTACCAGGCTTTTGTTGG + Intergenic
1128491684 15:68152865-68152887 GTTGATTAACTGTTTTTTTTTGG + Intronic
1130439582 15:83939420-83939442 TTTGATAAGTTGGTTTTTGTAGG + Intronic
1131246608 15:90799762-90799784 CTTGCTAATCTGTTTTTTGTTGG - Intronic
1133336620 16:5010800-5010822 CTTAAACACCTGGATTTTGTGGG - Intronic
1133828626 16:9301512-9301534 ATTGATTACGTGGTGTGTGTTGG + Intergenic
1133905358 16:10017104-10017126 CTTGATCACCTGCTCATTGTCGG - Intronic
1134155656 16:11841106-11841128 CTGGATTAACTGGCTTTTGAGGG - Intronic
1139000724 16:62506637-62506659 CTGGATGTCCTGGTTTTTGGTGG + Intergenic
1139377523 16:66509418-66509440 CTTATGTACCTGGTTTTTTTTGG - Exonic
1144312007 17:14022759-14022781 ATGCATTACCTGGTGTTTGTGGG + Intergenic
1144332751 17:14238560-14238582 ATGCATTACCTGGTGTTTGTGGG - Intergenic
1144628667 17:16858480-16858502 CTTGGTTACGTGGTCTTGGTTGG + Intergenic
1144652735 17:17017620-17017642 CTTGGTTACATGGTCTTGGTTGG - Intergenic
1144768948 17:17748407-17748429 GTTGATTGGGTGGTTTTTGTAGG + Intronic
1145160254 17:20569051-20569073 CTTGGTTACGTGGTCTTGGTTGG + Intergenic
1145849160 17:28074483-28074505 CTTGATTACTTTGTGTGTGTTGG + Intronic
1148597589 17:48869161-48869183 TGTGATTACCTGGGATTTGTGGG - Intergenic
1149040183 17:52178839-52178861 CTTAATTATCTGTTTTTTTTAGG + Intergenic
1149618604 17:58023617-58023639 CTTGATGCCTTGGTTTTTGATGG + Intergenic
1150514321 17:65791681-65791703 CTTGATTACCTAGATCTTGATGG - Intronic
1151050151 17:70969264-70969286 CATGTGTACCTGGATTTTGTAGG + Intergenic
1159809559 18:73000447-73000469 CTTGATTTTCTGGTTTATGTAGG - Intergenic
1160296282 18:77640282-77640304 CTGGATTCCCTGATTTTTGAAGG - Intergenic
1165544464 19:36522739-36522761 CTTTATTATCTGGTTGTGGTTGG - Intronic
1166314504 19:41981493-41981515 CCAGAGTACCTGGTATTTGTTGG + Exonic
1166952213 19:46436944-46436966 CTTAGTTACTTGTTTTTTGTTGG + Intergenic
926721681 2:15965848-15965870 CTGGATTTCCTGTCTTTTGTCGG + Intergenic
926899268 2:17732201-17732223 TTTGATTACATGATTTTTATAGG - Intronic
930218445 2:48721252-48721274 GTTGAATACCTTGTTTTTGGTGG + Intronic
930298986 2:49591950-49591972 CTTAATAAACTGATTTTTGTGGG + Intergenic
932276683 2:70456986-70457008 CATGACTACCTGGTCATTGTAGG + Intronic
933018791 2:77164999-77165021 CTTGATTCACTGATTTTTGAAGG - Intronic
936847648 2:116855915-116855937 CTAGATTTTCTGGTTTATGTGGG - Intergenic
938046005 2:128121285-128121307 CTACATTACCTGGCTTTGGTAGG - Exonic
939225966 2:139364557-139364579 GTTGCTTACCTTTTTTTTGTTGG - Intergenic
940497901 2:154457287-154457309 CTTGAGTACCTGGTTACTGCTGG - Intergenic
940631644 2:156247276-156247298 TTTGATTATCTGTTTCTTGTGGG + Intergenic
943922069 2:193721421-193721443 CATAATTACTTTGTTTTTGTAGG + Intergenic
944137545 2:196415337-196415359 CTTGATTCCCCTGTTTTTGTTGG - Intronic
944677933 2:202049606-202049628 CTTGGTTAAATGGGTTTTGTGGG - Intergenic
945579649 2:211577382-211577404 CTTGATTATCTGTTATTTATGGG - Intronic
946068064 2:217007137-217007159 CTTAAGTACCTGGTTTTGGAGGG + Intergenic
948047400 2:234954319-234954341 CCTGATTACTTTGTTGTTGTGGG - Intronic
1169457486 20:5764907-5764929 CTTGATTGACTTGTATTTGTAGG + Intronic
1169587375 20:7100801-7100823 CTTCAATCCCTGGTTTTTTTAGG - Intergenic
1169875977 20:10297378-10297400 CTTGCTTACCTTGTATTTGCCGG + Intronic
1173267489 20:41498285-41498307 ATTGATTACCTGTTTTCTTTTGG - Intronic
1174488397 20:50875247-50875269 CTTGGTGACCTGGTTTTTCCTGG + Intronic
1176692126 21:9927394-9927416 CTTGATTACCTTATTGTTGGAGG + Intergenic
1178526863 21:33337453-33337475 CTTCATTGCCTGCTTTTTCTTGG - Intronic
1178660726 21:34505437-34505459 CTTGATCACCTTTTTTTTTTTGG + Intergenic
1178755603 21:35346589-35346611 CTTTATTACCTGTGTTTTGTTGG + Intronic
949194428 3:1288266-1288288 CTTGATCACCTGGATTTTATTGG - Intronic
949435818 3:4028172-4028194 CTTGTTTGCCTGGTTGTTTTGGG + Intronic
949786204 3:7744468-7744490 CTTGGTTACCTGAGTCTTGTTGG - Intergenic
949912910 3:8928248-8928270 CTTCATTTCCTGCTTTTTTTTGG - Intronic
953431993 3:42847655-42847677 CTTGACAGCCTGGTTTTTGATGG - Intronic
953942036 3:47108327-47108349 CTTGATTACCTGCTTTTGAAAGG + Intronic
954034472 3:47843597-47843619 CCTGATAACCCGGGTTTTGTGGG + Intronic
955583507 3:60450776-60450798 CTTGAAAACATGGTTTTTGTTGG - Intronic
962636911 3:137340642-137340664 CTTGATGACTTGGGTTATGTAGG - Intergenic
968854857 4:3112126-3112148 CTTCTTTACATGATTTTTGTGGG + Intronic
971006434 4:22379080-22379102 CTGGATTCCCTGATTTTTGAAGG + Intronic
973034369 4:45387811-45387833 CTTGTTTAACTAGTTTCTGTAGG + Intergenic
973781276 4:54290407-54290429 CTTGTCTTCCTCGTTTTTGTAGG - Exonic
975539822 4:75496833-75496855 CTTTGTTGCCTGGTTATTGTGGG - Intronic
978223136 4:106302083-106302105 TTTGATTATCTTGTTTTTATTGG - Intronic
979423349 4:120533338-120533360 CTGGATTCACTGGTTTTTGAAGG + Intergenic
980238146 4:130135197-130135219 TGTCATTACCTGGTTTTTGTTGG - Intergenic
980245403 4:130233185-130233207 CTAGCTTACATGGTTGTTGTCGG + Intergenic
980364722 4:131787632-131787654 CTTGATTACCTTATTGTTGCAGG + Intergenic
982526717 4:156488346-156488368 ATTTATTACCTGATTTGTGTGGG + Intergenic
982588527 4:157274028-157274050 CTTGTTTACATGGTTTCTGAGGG - Intronic
983187651 4:164718727-164718749 GTTGATTACTTGGCTTTTGCAGG - Intergenic
983653064 4:170052800-170052822 CTTTATTATTTGTTTTTTGTTGG - Intergenic
983932553 4:173468837-173468859 CTTGATTTGATGGTCTTTGTTGG - Intergenic
984550295 4:181151658-181151680 CTTGATCACCTCCTTTTTGCAGG - Intergenic
985690187 5:1304641-1304663 CTTGTATACCTGGTTTTTTGAGG + Intergenic
987023884 5:13903683-13903705 CTTTATTCACTGATTTTTGTCGG - Intronic
988120413 5:26954174-26954196 CTGGATTACCAGGTCTCTGTTGG + Intronic
989830381 5:45910002-45910024 TTTGAATACATTGTTTTTGTAGG + Intergenic
991079792 5:62585992-62586014 TTTGGTTTCCTTGTTTTTGTTGG + Intronic
992390967 5:76330677-76330699 CTTGATTACCTGGTTTTTGTTGG + Intronic
992433615 5:76733620-76733642 CTTGCATACCTGCTTTTTATGGG + Exonic
993316753 5:86417170-86417192 CTTGATTACTTGCTTTCAGTTGG + Intergenic
999000397 5:147915310-147915332 CTAAATTACAAGGTTTTTGTGGG - Intergenic
1000543870 5:162574939-162574961 CTTGATTTCATGGTCTTTTTTGG - Intergenic
1001338468 5:170821706-170821728 CTGGCTTAACTGGTTTTTGTTGG + Intergenic
1004445738 6:15695802-15695824 AGTGATTACCTGGTATGTGTGGG + Intergenic
1005716373 6:28553333-28553355 CTTGATTGCCAGGAGTTTGTGGG + Intergenic
1007254486 6:40519182-40519204 ATTGATTACCTGCTGTGTGTTGG - Intronic
1008169299 6:48182888-48182910 TTTGATTACAGAGTTTTTGTTGG + Intergenic
1008881763 6:56387453-56387475 ATTGCTTACCTGATTTTTTTTGG - Intronic
1009581383 6:65538569-65538591 CTTAATTACCTACTTTTTTTGGG - Intronic
1018422773 6:163653715-163653737 CTTGATTATCTATTGTTTGTTGG - Intergenic
1020798227 7:12701560-12701582 CTTGTTTCCATTGTTTTTGTTGG + Intergenic
1021680211 7:23122395-23122417 CTTGATCACTTGTTTTTTGGTGG + Intronic
1024452408 7:49563318-49563340 CTTGATAACTTGGTCTTTCTTGG - Intergenic
1024665024 7:51537241-51537263 CCTGACTTCCTGGTTTTAGTTGG + Intergenic
1024897637 7:54279064-54279086 CTTCCTTGCCTGATTTTTGTGGG - Intergenic
1027437929 7:78185489-78185511 CTTGAATACATGTTTTATGTAGG + Intronic
1031286657 7:119878447-119878469 CACGATTACCTGATTTTTGTAGG - Intergenic
1032571035 7:132997296-132997318 CTTGATTACATAGATTTTTTTGG - Intronic
1032638493 7:133737734-133737756 TTTAATTACCATGTTTTTGTAGG + Intronic
1033506460 7:142007384-142007406 CTTGATTGCCTGGTTCTCCTAGG - Intronic
1033938602 7:146621704-146621726 CTTGATTACCTGGCTAAAGTAGG + Intronic
1035826946 8:2654854-2654876 CATGATTAGGTTGTTTTTGTAGG + Intergenic
1038781475 8:30571915-30571937 CATGATTACCTGGTTGGTTTGGG + Intronic
1039186466 8:34922968-34922990 CTTTATTGCCTTGTTTTTCTTGG - Intergenic
1041475188 8:58257401-58257423 CGTGATCACATGGTCTTTGTGGG - Intergenic
1041997115 8:64076208-64076230 TTTGATTACATGTTTATTGTTGG - Intergenic
1043814813 8:84789276-84789298 CTTGATTATCTGTAATTTGTGGG - Intronic
1046583624 8:116123815-116123837 ATTTATTTCCTTGTTTTTGTGGG + Intergenic
1047810973 8:128408967-128408989 CTTGATCATCTGGTTTGTGTTGG - Intergenic
1049115539 8:140683823-140683845 CTTCATTACCTAGTTTTTTGAGG - Intronic
1049847940 8:144812954-144812976 ATTGCTTTCCTGGTTTTTTTTGG - Intergenic
1049877640 8:145035891-145035913 CTTGACTTCCTGGTTTGAGTGGG + Intergenic
1051819724 9:21150138-21150160 CTTGATGATCTGGTCTTTCTTGG + Intergenic
1052668436 9:31523920-31523942 CTTGATAACCTGGGGTTTATGGG - Intergenic
1052921087 9:33969878-33969900 TTTGCTTAACTGGTTTTTTTTGG - Intronic
1053043018 9:34890720-34890742 CTGGATTCCCTTGTTTTTATGGG + Intergenic
1053197004 9:36127239-36127261 CCTGATTACCTGGTGGGTGTTGG - Intergenic
1053629067 9:39913487-39913509 CTTGATTACCTTATTGTTGGAGG + Intergenic
1053776701 9:41550084-41550106 CTTGATTACCTTATTGTTGGAGG - Intergenic
1054214820 9:62337215-62337237 CTTGATTACCTTATTGTTGGAGG - Intergenic
1054365027 9:64328401-64328423 CTTGATTACCTTATTGTTGGAGG + Intergenic
1054672661 9:67818134-67818156 CTTGATTACCTTATTGTTGGAGG + Intergenic
1056532616 9:87499660-87499682 TTTAATTACCTGGTTGGTGTTGG + Intronic
1056800626 9:89688276-89688298 TTTAGTTACCTTGTTTTTGTGGG - Intergenic
1057579533 9:96273925-96273947 CTTTATTAACTGGCTTTGGTGGG - Intronic
1059480241 9:114583709-114583731 CTTTATTTCCTAGTTATTGTGGG + Intergenic
1061199465 9:129128732-129128754 CTTTAGCACCTGGTTTCTGTAGG - Intronic
1186954950 X:14671534-14671556 CTGGATTTCCTGGTACTTGTTGG - Intronic
1188179713 X:27039716-27039738 CTTGATCACCTGGCTTAGGTAGG + Intergenic
1192450517 X:71241905-71241927 CTTGCTTGCCTGCTTTTTCTGGG - Intronic
1192656166 X:72997418-72997440 CTTGTTCAGCTGGTTTTTGAAGG - Intergenic
1192665954 X:73085583-73085605 CTTGTTCAGCTGGTTTTTGAAGG + Intergenic
1196228165 X:113189934-113189956 CTTGTATACCTGGATTTTCTGGG - Intergenic
1196765627 X:119239668-119239690 CTTCATTATCTGTTTTTTGGTGG - Intronic
1197580011 X:128270426-128270448 CCTGATTATGTGGTTTTTCTAGG - Intergenic
1198696424 X:139343570-139343592 CTTGATCATCTGTTTTTTGAAGG + Intergenic
1200037591 X:153343257-153343279 CTGGAGTAGCTGGATTTTGTGGG + Intronic
1200409263 Y:2845310-2845332 TTTGGTTTCCTGGTATTTGTGGG + Intronic