ID: 992391888

View in Genome Browser
Species Human (GRCh38)
Location 5:76337239-76337261
Sequence CTGAAGACACAGAGAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2640
Summary {0: 1, 1: 14, 2: 162, 3: 576, 4: 1887}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992391888_992391892 28 Left 992391888 5:76337239-76337261 CCATCTTCTCTCTGTGTCTTCAG 0: 1
1: 14
2: 162
3: 576
4: 1887
Right 992391892 5:76337290-76337312 CCTAATTTCCCTTTCTTATAAGG 0: 1
1: 5
2: 82
3: 487
4: 1341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992391888 Original CRISPR CTGAAGACACAGAGAGAAGA TGG (reversed) Intronic
Too many off-targets to display for this crispr