ID: 992397406

View in Genome Browser
Species Human (GRCh38)
Location 5:76380574-76380596
Sequence CTGTGGCTCTGGGAGTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992397396_992397406 21 Left 992397396 5:76380530-76380552 CCAGGAGCACAGCGCCTGCCTCG No data
Right 992397406 5:76380574-76380596 CTGTGGCTCTGGGAGTCAGAGGG No data
992397398_992397406 7 Left 992397398 5:76380544-76380566 CCTGCCTCGGCTTTCACACACTC No data
Right 992397406 5:76380574-76380596 CTGTGGCTCTGGGAGTCAGAGGG No data
992397399_992397406 3 Left 992397399 5:76380548-76380570 CCTCGGCTTTCACACACTCTACC No data
Right 992397406 5:76380574-76380596 CTGTGGCTCTGGGAGTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992397406 Original CRISPR CTGTGGCTCTGGGAGTCAGA GGG Intergenic
No off target data available for this crispr