ID: 992400481

View in Genome Browser
Species Human (GRCh38)
Location 5:76406765-76406787
Sequence AACACTTAAGTGACTACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992400477_992400481 -6 Left 992400477 5:76406748-76406770 CCACTGATAACCCAATCAACACT 0: 1
1: 0
2: 0
3: 3
4: 239
Right 992400481 5:76406765-76406787 AACACTTAAGTGACTACAGTGGG 0: 1
1: 0
2: 0
3: 15
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992400481 Original CRISPR AACACTTAAGTGACTACAGT GGG Intronic
902055455 1:13596902-13596924 AGCACCTCAGTGACTGCAGTGGG + Intronic
903172352 1:21562159-21562181 CACACTTAAAAGACTACTGTAGG - Intronic
905616784 1:39406867-39406889 AACACTTAAGTGAATGTATTTGG + Intronic
908406380 1:63817944-63817966 AACATTTCAGTTACTACAGTGGG - Intronic
910367566 1:86482991-86483013 ATCAGTTAACTGACTTCAGTGGG + Intronic
911308369 1:96260363-96260385 AACAATTAAGCCACTACACTGGG - Intergenic
912910080 1:113749791-113749813 AACTCTTAAGTGCCTGCAATAGG - Intronic
915392417 1:155556284-155556306 AACACTTGAGTGGCTAAAGTGGG + Intronic
918347868 1:183622191-183622213 AAGAATTAAGTGACAATAGTTGG + Intergenic
921246416 1:213246973-213246995 GAAACTTAAGTGACTATATTAGG - Intronic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
922659141 1:227414005-227414027 AACACTTAAGAGGCCACTGTAGG + Intergenic
922673662 1:227535260-227535282 AATATTTAAGTCAATACAGTGGG - Intergenic
923276958 1:232404875-232404897 CACACTTATGTATCTACAGTAGG + Intronic
1063281026 10:4629336-4629358 GAGACTTGAGTGACCACAGTGGG - Intergenic
1068280693 10:54865141-54865163 AACACTTGAGTCAGTAAAGTGGG + Intronic
1069096963 10:64270661-64270683 AACCCTTTATTGAGTACAGTAGG + Intergenic
1070016188 10:72534329-72534351 AAAAATTAAGTGACTATATTCGG + Intronic
1072266012 10:93728659-93728681 AACACTGAAGTGGTGACAGTGGG - Intergenic
1073736024 10:106347579-106347601 AACTCTTAACAGATTACAGTGGG - Intergenic
1074054731 10:109912421-109912443 ACCACTGAAGTGAATACAGTGGG + Intronic
1078737066 11:14030027-14030049 AGCACTTAAGTGACAAGAGCTGG + Intronic
1081109337 11:39114561-39114583 TACACTTAAGTGATTACAGATGG + Intergenic
1082271965 11:50182130-50182152 CACACTTAAGTGGCTGAAGTAGG + Intergenic
1084612040 11:70209400-70209422 AAAACTCTAGTGACTACACTGGG + Intergenic
1086494961 11:87393437-87393459 AACACTTAAGAGGCCACAATAGG - Intergenic
1092456632 12:8649698-8649720 AATACTTAAGAAAATACAGTTGG - Intronic
1098973844 12:76881520-76881542 AACAATTAAGAGTCTTCAGTAGG + Intergenic
1099464994 12:82973775-82973797 AACACTTTAATGCCTATAGTAGG + Intronic
1099994451 12:89763399-89763421 ACCTCTTAAGTGAATACAGTGGG + Intergenic
1101271340 12:103148779-103148801 AACACTTAATTCACCAGAGTAGG - Intergenic
1102325831 12:111982949-111982971 GATACTTCAGTGACTACATTAGG + Intronic
1104378784 12:128288723-128288745 CAGACTTCAGAGACTACAGTGGG - Intronic
1109523895 13:63549240-63549262 AACTCTTTCCTGACTACAGTTGG - Intergenic
1111256187 13:85671837-85671859 AACACCTGTGTTACTACAGTTGG - Intergenic
1112086427 13:96036864-96036886 ACTACTTAAGTGGCTGCAGTGGG - Intronic
1112755714 13:102630891-102630913 AATACCTTAGTGCCTACAGTGGG + Intronic
1117185023 14:53231482-53231504 GACATTTAAGTGGCTGCAGTAGG + Intergenic
1118583948 14:67333353-67333375 AACACTTAAATGACTTCATTGGG + Exonic
1122030685 14:98909303-98909325 ATCACTAACTTGACTACAGTCGG + Intergenic
1122368314 14:101212035-101212057 AAGACTTAAGTTACTAAAGTTGG - Intergenic
1126408642 15:48349280-48349302 ATCAATTAATTGACTTCAGTGGG + Intergenic
1135857246 16:26023066-26023088 TACACTGAAGTGAATACAGTTGG - Intronic
1136684767 16:31987694-31987716 CACACTTAAGTGTTTCCAGTAGG + Intergenic
1136785382 16:32931229-32931251 CACACTTAAGTGTTTCCAGTAGG + Intergenic
1136884392 16:33922575-33922597 CACACTTAAGTGTTTCCAGTAGG - Intergenic
1142477396 17:197335-197357 CACACTCAACTGACTAGAGTTGG - Intergenic
1143938005 17:10507566-10507588 AACCCTTAAAAGACTCCAGTGGG - Intronic
1149447590 17:56725615-56725637 AACACTTGAGGGACAACAGAGGG + Intergenic
1149545854 17:57503390-57503412 AACACTGAAGTGTTAACAGTGGG + Intronic
1154137938 18:11796854-11796876 AAAAATTAAATGACTACATTAGG - Intronic
1156791333 18:40978218-40978240 AACACTTATTAGTCTACAGTTGG + Intergenic
1156923249 18:42548538-42548560 AATACTTAAGTAGCTATAGTAGG + Intergenic
1157551767 18:48587028-48587050 AACACTAGAGTGGCCACAGTGGG - Intronic
1160372787 18:78388814-78388836 AAGACTTAAGTGGCTAAATTGGG - Intergenic
925106292 2:1295419-1295441 AACACTGAAGTTACTAAAATGGG - Intronic
926880563 2:17539959-17539981 AACACTTAAGTGCATACAGAAGG + Intronic
926979430 2:18552110-18552132 AACAAGTAAGTGAGTACATTGGG + Intergenic
928072383 2:28230258-28230280 AAAATTTAAGTGAGTACAATAGG - Intronic
928742096 2:34366913-34366935 AAAACTTAATGGGCTACAGTGGG - Intergenic
928960375 2:36919728-36919750 GACAGTTAAGTTACTACAGTAGG + Intronic
931760666 2:65413846-65413868 AATACTTAAGTCACCACATTTGG - Intronic
934050667 2:88207868-88207890 AACACTTAAGTCACACCAGAGGG + Intergenic
935693457 2:105750377-105750399 AACCCCTAAGTGACTATATTTGG - Intronic
935933801 2:108158972-108158994 AACACTTTTGTGACTATATTGGG - Intergenic
941600834 2:167542343-167542365 AACACTTAACTTTCTACAATGGG + Intergenic
942238295 2:173934254-173934276 AACACTTAATTGATTAGAATGGG + Intronic
943165279 2:184315049-184315071 AAAATTTAAGTGAGTGCAGTTGG - Intergenic
943263365 2:185694967-185694989 ATTATTCAAGTGACTACAGTGGG - Intergenic
943655530 2:190504190-190504212 AAAACGGAAGTGATTACAGTAGG + Intronic
943974381 2:194453141-194453163 AACAAATAAGTGAATACAGCAGG - Intergenic
943993557 2:194730396-194730418 GATTCTTAAGTGACAACAGTTGG + Intergenic
944324040 2:198382587-198382609 AACACTTAATTGCCTCCTGTTGG - Intronic
944365002 2:198908028-198908050 AACATTTCTGTCACTACAGTAGG + Intergenic
947035476 2:225849168-225849190 AACACTTAAGAGACCATTGTAGG + Intergenic
1168786034 20:541198-541220 AGGACTTAAGTGACTAGATTCGG + Intronic
1169773645 20:9228731-9228753 AACACTTCAGTAACTATAATGGG + Intronic
1173995000 20:47331190-47331212 AACACTTAAGAGTTTAAAGTAGG + Intronic
1178876592 21:36419003-36419025 GACACTGAAGTGACTTCACTTGG - Exonic
1179561119 21:42216837-42216859 AACACAGCAGTGACTACAGTGGG + Intronic
1180860249 22:19075124-19075146 ACCACTTAAGAGTGTACAGTTGG + Intronic
1182950756 22:34373570-34373592 AACTATTAAGTGACTACTTTTGG + Intergenic
950899742 3:16486814-16486836 ACCCCTAAAGTGACTACATTTGG + Intronic
953483982 3:43277086-43277108 AACACTTAGGAGACCACTGTAGG - Intergenic
956465043 3:69511669-69511691 AACACTTCAGTGATGCCAGTGGG - Intronic
958415178 3:93865401-93865423 AACTCCAAAGTGACTACATTTGG - Intergenic
961969764 3:130949057-130949079 AACACTTAAGAGGCCACTGTAGG - Intronic
962035692 3:131649311-131649333 AGCTCTTCAGTGACAACAGTGGG - Intronic
962045593 3:131756632-131756654 AACACCTAAGGGGCTCCAGTTGG + Intronic
964260531 3:154830593-154830615 AACACTTAAGGGAGGAGAGTTGG + Intergenic
966213180 3:177473997-177474019 AACACTAAAATGACTAAACTGGG - Intergenic
966843575 3:184108262-184108284 AAGACTGAAGTGACAACTGTTGG + Intergenic
970914161 4:21312866-21312888 TTCACTTAAGTGATTACATTTGG - Intronic
971747463 4:30602280-30602302 AAGATATAAGTGACTACAATGGG - Intergenic
972636743 4:40891021-40891043 AACATTTAAATGACAACATTAGG + Intronic
972789361 4:42356061-42356083 AAGACCTAAGGGACTACAGAGGG + Intergenic
974805718 4:66877687-66877709 AAAACTTAGGTAACTAGAGTTGG + Intergenic
975096287 4:70460863-70460885 AACACCTATGTGGCTGCAGTAGG - Intronic
977543349 4:98345760-98345782 CACACTTAAGTGATGATAGTTGG + Intronic
978649017 4:110977965-110977987 GACACTGAGGTGACTATAGTTGG + Intergenic
981995535 4:150970197-150970219 CACACTTAACAGACTAAAGTAGG + Intronic
983549407 4:169000631-169000653 AATTCTTAAGTACCTACAGTAGG + Intronic
985917704 5:2936884-2936906 CACACCTTTGTGACTACAGTTGG + Intergenic
987297411 5:16566006-16566028 AACACTTGGGTGAGTACCGTGGG + Intronic
987751649 5:22046980-22047002 AACATTTCTGAGACTACAGTGGG - Intronic
988945788 5:36197308-36197330 AAAACTTAAGTGACTAGAAAGGG - Intronic
989666744 5:43863276-43863298 AAAACTTATGTGCCTGCAGTTGG - Intergenic
991121266 5:63017228-63017250 AAGACTTGAGTCACTACAGAGGG - Intergenic
991143192 5:63270888-63270910 AGCACTTAAGTGTATACATTTGG - Intergenic
991568896 5:68034077-68034099 AACTCATTAGTGACTAGAGTGGG - Intergenic
992374644 5:76176191-76176213 AAGACTTAAGTGATTACCGATGG + Intronic
992400481 5:76406765-76406787 AACACTTAAGTGACTACAGTGGG + Intronic
1001499869 5:172222571-172222593 AACAGAAAAGTGACTAGAGTTGG + Intronic
1002603009 5:180365274-180365296 CACACTTAATAGACTATAGTAGG + Intergenic
1004435493 6:15589020-15589042 AATACTTAAGTGACTCAGGTTGG - Intronic
1004465065 6:15877406-15877428 AACACTTCCTTAACTACAGTAGG - Intergenic
1004926680 6:20422624-20422646 AACACTTAAGAGACCATTGTGGG + Intronic
1005941941 6:30566996-30567018 AACACTTTAGTGCCTACTGTAGG + Intergenic
1008223786 6:48886869-48886891 CACACTTAATAGACTACAGTAGG + Intergenic
1010265340 6:73859396-73859418 GCCATTTACGTGACTACAGTGGG + Intergenic
1011681332 6:89786342-89786364 AACACTTAGGAGGCCACAGTGGG + Intronic
1015966239 6:138697288-138697310 AAGACTCAAGTGACTGCAGATGG - Intergenic
1018394608 6:163368440-163368462 AACTCTTAAGTGCCTAAAATTGG - Intergenic
1020440753 7:8214221-8214243 GACACTTAATTGACCACAGGAGG + Intronic
1020833346 7:13118522-13118544 AACACTTAAGAGACAACTGTAGG - Intergenic
1025624199 7:63204263-63204285 CACACTTAAGTGGCTGAAGTAGG + Intergenic
1039104455 8:33974980-33975002 AACACCTCAGTAATTACAGTGGG + Intergenic
1040994569 8:53388870-53388892 AACAAATAATGGACTACAGTTGG + Intergenic
1041331911 8:56735830-56735852 AACAGGAAAGTGACTCCAGTAGG - Intergenic
1046865484 8:119145400-119145422 AAGACTGAAATGACTACTGTAGG - Intergenic
1047791417 8:128207409-128207431 AACAAGTAAGTGACTGCAGTAGG + Intergenic
1051852991 9:21530587-21530609 AACACTTAAGAGGCCACTGTTGG + Intergenic
1052715930 9:32117097-32117119 AACACTTATGTTACTACCTTGGG - Intergenic
1055660632 9:78500548-78500570 AACCCTTAAGTGACTAGCCTGGG + Intergenic
1056859548 9:90167261-90167283 AAAACTTATGGGACTAAAGTGGG - Intergenic
1057059678 9:91992433-91992455 AACACTTAAGTGACCAAAAAAGG - Intergenic
1057853326 9:98582194-98582216 AGGACTTATGTGACTACACTGGG - Intronic
1058286382 9:103184955-103184977 ATCACTTATGTGATTACATTGGG - Intergenic
1059323569 9:113487964-113487986 AACACCAAAGTGACTGCAGGAGG - Intronic
1060114925 9:120932419-120932441 AACACGTAAGTGAATCCAGCCGG + Intergenic
1187576918 X:20566595-20566617 AACACTTTTGTCACTATAGTGGG + Intergenic
1187646819 X:21356519-21356541 ACCACTGAAGTGACTCTAGTGGG + Intergenic
1187769922 X:22683583-22683605 GACAAAAAAGTGACTACAGTTGG + Intergenic
1188679074 X:32979340-32979362 AACACTTTGGTAACAACAGTAGG - Intronic
1194683896 X:96887794-96887816 AACACTTAAATGCATATAGTAGG - Intronic
1201954145 Y:19602891-19602913 AAAACTTAAGTGACTGCAAATGG - Intergenic