ID: 992400857

View in Genome Browser
Species Human (GRCh38)
Location 5:76410002-76410024
Sequence CTTGTTTAGCACTATGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992400857 Original CRISPR CTTGTTTAGCACTATGTGCC AGG (reversed) Intronic
901167861 1:7232585-7232607 CCTGTGTAGCACTCTGTTCCCGG + Intronic
901909062 1:12439701-12439723 CTTACTTAGCACTATTTGCCAGG - Intronic
904334591 1:29788358-29788380 TTTATTGAGCACTATGTACCAGG + Intergenic
904539947 1:31226069-31226091 CTTATCAAGCACTATGTGCCAGG - Intronic
904542911 1:31245599-31245621 CTTATCAAGAACTATGTGCCAGG + Intergenic
906848387 1:49219799-49219821 CTTGCTTAGCACTATGTCAAAGG - Intronic
907381516 1:54094706-54094728 TTTATTCAGCACTATGTGCCAGG - Intronic
907484990 1:54771408-54771430 CTGGATGAGCACTCTGTGCCGGG - Intergenic
909580415 1:77227296-77227318 TTTATTAAGCACTATGTACCAGG + Intergenic
909782994 1:79572712-79572734 CTTGTGTAGTACTATTTGCCAGG - Intergenic
910762517 1:90748035-90748057 GGTGTTTACCACTATGTCCCCGG - Intergenic
910825174 1:91399110-91399132 CTTACTGAGTACTATGTGCCAGG + Intronic
911269337 1:95781396-95781418 ATTTTTGAGCACTATGTGCCTGG + Intergenic
912768154 1:112435374-112435396 CTTATTTACCACTATATCCCAGG + Intronic
916804898 1:168249927-168249949 CTTATCTAGTACTATGTGCCCGG + Exonic
917241684 1:172955631-172955653 CTTGTTTTGCACTAACTGGCTGG + Intergenic
917739840 1:177951774-177951796 TTTGTTAATCACCATGTGCCAGG - Intronic
918003735 1:180522685-180522707 TTTATTGAGCACCATGTGCCAGG - Intergenic
918391438 1:184067470-184067492 CTTACTTAGCACCATGTACCAGG - Intronic
919353393 1:196489267-196489289 ATTGTTTGCCACTTTGTGCCAGG + Intronic
920674848 1:208031699-208031721 CTTGTTCAGCACTGTGCACCGGG - Exonic
920938502 1:210458338-210458360 CTTGTTTTGTGTTATGTGCCAGG + Intronic
921000970 1:211042408-211042430 TTTGTTCAACACTATATGCCAGG - Intronic
922330849 1:224574438-224574460 ATTGTTGAGCACAATGTGGCTGG - Intronic
924122176 1:240812236-240812258 TTTATTGAGCATTATGTGCCAGG + Intronic
924674768 1:246164693-246164715 CTTGTTCAGGACTGTGTGCCTGG - Intronic
1063228860 10:4043943-4043965 CCTGTTGATCACTATGAGCCAGG + Intergenic
1064252251 10:13715590-13715612 TTTCTTCAGCACTATGTACCAGG - Intronic
1067923110 10:50480323-50480345 TTTATTTAGCACTAACTGCCAGG - Intronic
1069059518 10:63880723-63880745 CTTGAATAGCACTATAGGCCAGG - Intergenic
1069560519 10:69426171-69426193 CTTATTTAGCCCTTTGTGTCAGG - Intergenic
1069846019 10:71372220-71372242 CTTATTGAGCACTATGAACCGGG + Intergenic
1069985270 10:72278633-72278655 TTAGTTAACCACTATGTGCCAGG - Intergenic
1073364586 10:102928173-102928195 CTGGTTAAGCACAAAGTGCCAGG - Intronic
1073401015 10:103257694-103257716 CTTCTTTAAAACTATATGCCAGG - Intergenic
1073828112 10:107349270-107349292 CTTGTTTAGCACTATGTTAAAGG - Intergenic
1074480782 10:113818406-113818428 CTTGTTTAGTACTCTGTCCTGGG - Intergenic
1075186559 10:120264526-120264548 CATGTTTTGCACTTTGTGCAGGG + Intergenic
1076249210 10:128971891-128971913 CTTGTATAGCCCTAAGTGCGGGG - Intergenic
1079138514 11:17791821-17791843 TTTATGTAGTACTATGTGCCAGG - Intronic
1079453883 11:20620591-20620613 TTTGTTGAACACTGTGTGCCAGG + Intronic
1081301856 11:41462257-41462279 CTTGATTTGTACTATGTGTCTGG + Intergenic
1082079674 11:48002509-48002531 CTTATTGAGCACTTTGTGCTAGG + Intronic
1082991411 11:59210580-59210602 CTTGTTTAGGTCTCTGGGCCAGG - Exonic
1083000546 11:59287198-59287220 CTTGTTTAGGTCTCTGGGCCAGG - Intergenic
1085011480 11:73144201-73144223 CTTATTAAGCACTACATGCCAGG - Intergenic
1085324691 11:75597586-75597608 CTTGTCTAACACTATGCTCCTGG + Intronic
1085381411 11:76122516-76122538 CTTATTTATTACTAAGTGCCAGG - Intronic
1086435918 11:86781214-86781236 CTTATATAGCACTATGTAACAGG + Intergenic
1086514629 11:87597621-87597643 ATTGGGAAGCACTATGTGCCAGG - Intergenic
1086582792 11:88418590-88418612 CTGTTTTAGCACTCTGTGCCAGG + Intergenic
1088064558 11:105700380-105700402 CTGGTTTAGCAATATGTGTCTGG - Intronic
1088335366 11:108697977-108697999 CTAATTTAGCCTTATGTGCCTGG + Intronic
1089339214 11:117746249-117746271 CTTATATAGCACTATGTGCCAGG - Intronic
1090711747 11:129392549-129392571 CTGGTATAATACTATGTGCCAGG + Intronic
1094029254 12:25992347-25992369 CCTGTTTAGCTCTATGACCCTGG + Intronic
1095441224 12:42240034-42240056 TTTTTTGAGCACTATGTGCCAGG + Intronic
1095448667 12:42306600-42306622 CATATTTAGCACTATGTTTCAGG - Intronic
1095909698 12:47413871-47413893 CTTATTAAGCACTATGTACCAGG + Intergenic
1095943894 12:47743131-47743153 CTTATGTATCACTATGTGCCGGG + Intronic
1096459278 12:51813423-51813445 CTTATTGCGCACTGTGTGCCAGG - Intergenic
1097639643 12:62164843-62164865 TTTGTTTAGCCCTCTGTGCCAGG - Intronic
1097995624 12:65884911-65884933 CACATATAGCACTATGTGCCAGG - Intronic
1100372589 12:93982070-93982092 CTTGTTTATCAATATATGCAGGG + Intergenic
1101652329 12:106688917-106688939 CCTGCTTAGCTCTATGTGCCAGG + Intronic
1101914293 12:108884422-108884444 CTTGTGAAGCACTTAGTGCCGGG + Intronic
1101963579 12:109267267-109267289 CATGTTTAGCACTGGTTGCCAGG + Exonic
1102505404 12:113381387-113381409 CTTGTTTAGAAATCTGTCCCTGG + Intronic
1106173192 13:27306889-27306911 CTTTTTTAGCCATATGAGCCAGG + Intergenic
1108754103 13:53478922-53478944 TTTACTGAGCACTATGTGCCAGG + Intergenic
1108770329 13:53693070-53693092 CTTGATTCACACTATGTGGCAGG + Intergenic
1110546679 13:76763951-76763973 TTTATTGAGAACTATGTGCCTGG + Intergenic
1110552714 13:76826757-76826779 CTTGGTAAGCGCTATGTGCCTGG - Intergenic
1110849738 13:80231664-80231686 TTTATTGAGCACTATGTGCTAGG + Intergenic
1111123407 13:83881724-83881746 CTTGCCTTGCACTACGTGCCTGG - Exonic
1114392137 14:22321102-22321124 CTTATGTAACACTACGTGCCAGG - Intergenic
1114810676 14:25895215-25895237 CTTATAGAGCCCTATGTGCCAGG - Intergenic
1115334591 14:32232137-32232159 CTTATATAGCATTAAGTGCCAGG - Intergenic
1121199102 14:92102668-92102690 CTTCTACAGCACTATCTGCCAGG + Intronic
1125069657 15:35537917-35537939 AGTGTCTAGCACTATATGCCAGG + Intronic
1125806954 15:42501759-42501781 TTTATTGAGCACTGTGTGCCAGG + Intronic
1127766413 15:62189520-62189542 CTTCTTTAGCCCTATTTGTCAGG - Intergenic
1128976172 15:72155395-72155417 CTTGTTTGCCACTCAGTGCCTGG - Intergenic
1130345635 15:83042310-83042332 ATTATTAAGCACTACGTGCCAGG + Intronic
1130559353 15:84946371-84946393 CTTATGTGGCACTGTGTGCCAGG + Intergenic
1132123387 15:99197513-99197535 CATATTTAGCACTATGTATCAGG + Intronic
1133273502 16:4623287-4623309 CTTACTGAGCATTATGTGCCAGG - Intronic
1134074586 16:11281613-11281635 CTTGTTTATCACTATATACCAGG - Intronic
1138015620 16:53425748-53425770 CTAATTTAGGAGTATGTGCCTGG - Intergenic
1138966672 16:62092999-62093021 CTTATTAATCACTATGTGCCAGG - Intergenic
1139735958 16:68988469-68988491 CTTGAGTAGCACTATGTGCATGG - Intronic
1141161582 16:81632754-81632776 CTAGGTTTGCACCATGTGCCTGG + Intronic
1141281720 16:82635197-82635219 TTTGCTGAGTACTATGTGCCAGG - Intronic
1143951767 17:10638274-10638296 CTTGTTGAGCTCTATCTGCGTGG + Exonic
1151337819 17:73450443-73450465 TTTCATGAGCACTATGTGCCGGG + Intronic
1152858663 17:82681482-82681504 CTTGTTTCGCACTCAGAGCCTGG - Intronic
1152972685 18:179345-179367 CTTATATAGTACTATCTGCCAGG - Intronic
1153406082 18:4741076-4741098 TTTGTTTAACACTCAGTGCCGGG - Intergenic
1155558090 18:27043893-27043915 CTTGTTTATGACTCTGTTCCAGG + Intronic
1157313086 18:46566690-46566712 CTTGTTTCTCACTATGGCCCTGG - Intronic
1157427006 18:47592726-47592748 CTTTTCTAGATCTATGTGCCAGG + Intergenic
1157836898 18:50912390-50912412 TTTGCTTAACACTATATGCCTGG - Intronic
1158331981 18:56372751-56372773 CTTACTGAGCACTATGAGCCAGG + Intergenic
1162486766 19:10965368-10965390 ACTGTTTAGCACTATGTGCCAGG - Intronic
1165258053 19:34591957-34591979 CTTGTTTTCCACTGGGTGCCCGG + Intergenic
1168556812 19:57350340-57350362 TGTATTTAGCACGATGTGCCAGG + Intergenic
927291990 2:21413555-21413577 CTTGTTTTACACTGTGTGCTAGG - Intergenic
927831522 2:26355111-26355133 CTTATACAGCACTATGTGCCAGG - Intronic
928748683 2:34445952-34445974 CTGGATTATCACTATGTTCCAGG + Intergenic
930171069 2:48252311-48252333 TTTGTTAAACACTAGGTGCCAGG + Intergenic
930584549 2:53253927-53253949 CTTGGATCTCACTATGTGCCAGG + Intergenic
934078439 2:88447883-88447905 TTTGTTTATCACTGTATGCCAGG - Exonic
937498252 2:122449143-122449165 ATGGTTTAGCACCATGTGCTTGG - Intergenic
938936925 2:136135308-136135330 CTTGCTGAGCACTCTGTCCCAGG + Intergenic
940134709 2:150423215-150423237 CCTGTTTACCACAATGTCCCTGG - Intergenic
940722459 2:157297338-157297360 TTTATTGAGCACTCTGTGCCAGG + Intronic
940859777 2:158759732-158759754 CTATTTTAGCTTTATGTGCCAGG + Intergenic
943018481 2:182544284-182544306 TTTGTTTACCACTATCTGTCAGG - Intergenic
944823033 2:203450571-203450593 CTTATTGAGAACTATTTGCCAGG + Intronic
945690677 2:213031144-213031166 CTTCTTTAACAGGATGTGCCAGG + Intronic
946876294 2:224132974-224132996 CATTTTTAGCACTACATGCCAGG - Intergenic
947083343 2:226422959-226422981 CTTAGTGATCACTATGTGCCAGG - Intergenic
947997859 2:234543993-234544015 TTTGCTGAGCACTGTGTGCCAGG + Intergenic
1170021526 20:11841594-11841616 CTTGAATAGTGCTATGTGCCAGG + Intergenic
1170377427 20:15715919-15715941 ATTGTTTATCACTATATGCATGG - Intronic
1172316661 20:33960758-33960780 CATGTTTAACACTAGGTGCAAGG - Intergenic
1173159482 20:40641777-40641799 CTTGTTAGCCACTCTGTGCCAGG + Intergenic
1173797087 20:45869154-45869176 CTTGTTTATCACTATCTGGGTGG + Intronic
1173833124 20:46105551-46105573 CTTATTTAGCATTAAGTGGCAGG - Intergenic
1173913459 20:46688538-46688560 TTTATTGGGCACTATGTGCCAGG + Intronic
1183384376 22:37506489-37506511 CTTACTGAGCACTGTGTGCCGGG + Intronic
1183522024 22:38300991-38301013 CTTGCCTAGCACTCTGGGCCAGG + Intronic
951000375 3:17552560-17552582 CTTATTTAGTACTATGTCCTAGG - Intronic
952203706 3:31157844-31157866 CTTTTTATGCACTTTGTGCCAGG - Intergenic
952665541 3:35899890-35899912 CTTGTCAATCTCTATGTGCCAGG + Intergenic
952955977 3:38557455-38557477 CTTGTTTAGCACTAGGGGTGGGG + Intronic
954704579 3:52472501-52472523 CGTGTTTGGCAGTATGTGACAGG + Intronic
955321810 3:57979869-57979891 TTTCTTGAGCACCATGTGCCAGG + Intergenic
956536018 3:70277811-70277833 GTTGTTGAGATCTATGTGCCAGG + Intergenic
956898524 3:73688551-73688573 CTTGTTTATCACTATAACCCCGG - Intergenic
957894506 3:86403851-86403873 CTTATTGAGCACTATGTACTAGG + Intergenic
959353159 3:105294121-105294143 GTTATTGAGCAGTATGTGCCAGG - Intergenic
961058878 3:123811574-123811596 TTTGTTTAGCACAGTGTCCCCGG - Intronic
962458039 3:135583322-135583344 TTTATTGAGCACTTTGTGCCAGG - Intergenic
962499309 3:135973786-135973808 CTAATTTATCACTATGTGCCAGG + Intronic
963864800 3:150349146-150349168 CTTTTTAAGCACTATGTTACAGG - Intergenic
964736274 3:159921897-159921919 TATTTTTAGCACTTTGTGCCTGG + Intergenic
965090909 3:164161916-164161938 CTTCTTGAGCACTATCTTCCTGG + Intergenic
965608770 3:170523085-170523107 CTTATTTAGTGCTATGTGCTCGG + Intronic
965918229 3:173877767-173877789 TTTGTGTAGCAGTATGTACCAGG + Intronic
966121506 3:176526529-176526551 TTTATTGAGCAGTATGTGCCAGG + Intergenic
966936837 3:184716152-184716174 CTGGTTCAGCACTTTGTCCCAGG - Intergenic
969829688 4:9784927-9784949 TTTATTAAGCACTATGTGCCAGG - Intronic
969885919 4:10215330-10215352 CTTGAGAATCACTATGTGCCTGG + Intergenic
970169724 4:13277612-13277634 CTTGTTAAGCACTCTTTGCCAGG - Intergenic
972968802 4:44547059-44547081 TTTATTGAGCACTATGTGCCAGG + Intergenic
973332744 4:48925911-48925933 CTTATGTATTACTATGTGCCAGG - Intergenic
974558279 4:63481379-63481401 TATGTTAAGCACTAAGTGCCTGG + Intergenic
975185485 4:71397350-71397372 CTTGTTTAGGACTTACTGCCTGG - Intronic
976590164 4:86841962-86841984 TTTATTGAGCACTATGTGCTAGG + Intronic
976902292 4:90193288-90193310 TTTATTGAACACTATGTGCCAGG - Intronic
981352127 4:143743700-143743722 CGGGTTTAGGACTATGTGCTTGG - Intergenic
982674041 4:158355330-158355352 CCTGTTTAGCACTTTTTGCCAGG + Intronic
984672464 4:182506459-182506481 CTTTTTAAGCACCATGTGCCAGG - Intronic
985309494 4:188581688-188581710 CTTGTTTTGCCCTATGTGCGTGG + Intergenic
985397517 4:189559714-189559736 CCTGTTTATCACTCTGTGACTGG - Intergenic
992400857 5:76410002-76410024 CTTGTTTAGCACTATGTGCCAGG - Intronic
992572703 5:78076284-78076306 CTTGTTTACCACTATATCCATGG + Intronic
992610002 5:78499309-78499331 CTTGTTGAGCACTCTGTGCTAGG + Intronic
993410692 5:87569711-87569733 CTTGTTCATCACAATGTCCCTGG - Intergenic
994502181 5:100593083-100593105 CTTTTTAAGCACTGGGTGCCTGG + Intergenic
995704782 5:114976999-114977021 ATTGTTTTGCCATATGTGCCTGG - Intergenic
996096977 5:119409294-119409316 CTCATTTAGTACCATGTGCCTGG + Intergenic
996199777 5:120657619-120657641 CTTGTTTAGCTCCAGGTGCAGGG - Intronic
998229263 5:140349286-140349308 CTTCCTTAGGACTATGTTCCTGG - Intergenic
999480879 5:151947263-151947285 TTTGCTGAACACTATGTGCCTGG + Intergenic
999790919 5:154938535-154938557 TTTTTTGAGCGCTATGTGCCAGG + Intergenic
1001765251 5:174240744-174240766 CTTTTTTGGTACTATGTGGCAGG - Intronic
1004187713 6:13435149-13435171 CTTTATTAGCACTCTGTTCCCGG - Intronic
1004529921 6:16444348-16444370 CTAGTATAACACTATGTTCCAGG - Intronic
1005704185 6:28435333-28435355 CTTGTTTATCACTGTATCCCTGG + Intronic
1006562940 6:34929380-34929402 CCTGTTTAGCAGTATCTGCCTGG + Intronic
1009296340 6:61953852-61953874 CTTGTTTAGGTTTATTTGCCTGG - Intronic
1009337475 6:62510187-62510209 ATTATTGATCACTATGTGCCAGG + Intergenic
1010443696 6:75927791-75927813 ATTTTTGAGCACCATGTGCCAGG - Intronic
1010473509 6:76259344-76259366 CTTATGTAACACTATGTGCCAGG + Intergenic
1010811546 6:80306096-80306118 CTTGCTGAGCACTATGTGCCAGG - Intronic
1011207051 6:84911117-84911139 CTAGTTTACCACTATATGCCTGG + Intergenic
1012686021 6:102250603-102250625 ATTGTTTAGCACTATCTTCTTGG + Intergenic
1013417137 6:109935034-109935056 ATTTTTGAGCACTATGTGTCAGG + Intergenic
1013645061 6:112129266-112129288 CCTGTTAATAACTATGTGCCTGG + Intronic
1014865956 6:126530525-126530547 CTTGTTTAGCAATATGAGGAGGG + Intergenic
1016442030 6:144094478-144094500 TTTGTTGAGCTCTATGTGACAGG - Intergenic
1017471615 6:154742969-154742991 CTGGTTTACCACTATATCCCAGG - Intronic
1017681831 6:156872239-156872261 TTTATTGAGCACTAAGTGCCAGG - Intronic
1022220302 7:28307714-28307736 TTTGCTGAGCACAATGTGCCTGG + Intronic
1023248241 7:38230430-38230452 CTTGTTTTGCATTATGTGTATGG + Exonic
1023472726 7:40542139-40542161 GTTATTTAGCACTATGTGTCAGG + Intronic
1024365880 7:48519937-48519959 CTTGGTTAGCTCTGTGTTCCAGG - Intronic
1027384908 7:77649900-77649922 CATGTTTAGCACAATATGCAAGG - Intergenic
1028110717 7:86937787-86937809 TTTATTGAGCACTATGTGACAGG + Intronic
1029878024 7:103773942-103773964 CTTATTTAGCACTGTGAGCTAGG + Intronic
1032008616 7:128325675-128325697 CTTATTTAGCACTTTGTGTTAGG - Intronic
1035707022 8:1683599-1683621 ATTGTCTGGCACTCTGTGCCAGG - Intronic
1036211059 8:6841697-6841719 CTTGTTCAGCACTGTCTCCCAGG + Intergenic
1037206564 8:16328039-16328061 TTTGTTTGGCACTAGGTGCTAGG + Intronic
1037698618 8:21251102-21251124 TTTGTTTATCACTGTATGCCTGG - Intergenic
1038843983 8:31211989-31212011 ATTATATAGCATTATGTGCCAGG - Intergenic
1040978676 8:53222180-53222202 CTTGGATATCACTATGTGCTAGG - Intergenic
1042460312 8:69058157-69058179 AATATTTAGCACTTTGTGCCAGG + Intergenic
1044719486 8:95132144-95132166 CTTGTAAAGCACTGTGTGCCAGG + Intergenic
1044803313 8:95979145-95979167 ATTGATTACCACTATGTTCCAGG - Intergenic
1047176943 8:122550705-122550727 CTTGTTTATAGCTATATGCCTGG - Intergenic
1048273691 8:133049630-133049652 GCTGTTTACCACTCTGTGCCAGG + Intronic
1051525268 9:18036030-18036052 CTTGTGTAGCACAGTGTTCCTGG - Intergenic
1052018663 9:23499489-23499511 AATGTTTTCCACTATGTGCCAGG + Intergenic
1054876016 9:70097066-70097088 ATTGATTAGCAATATCTGCCTGG - Intronic
1055138941 9:72853345-72853367 ATTATTGAGCACTATGTGCCAGG - Intergenic
1056159992 9:83879575-83879597 CTTATCTAGTACTATGTGCCAGG - Intronic
1056360234 9:85850243-85850265 CTTATCTAGTACTATGTGCCAGG + Intergenic
1057324991 9:94054024-94054046 ACTGAGTAGCACTATGTGCCAGG + Intronic
1058077364 9:100664567-100664589 CTTGGTTAGCACTAGGAGGCTGG + Intergenic
1058584920 9:106497095-106497117 ATTGTATAGAACTATGTGCGTGG - Intergenic
1058801978 9:108553171-108553193 CTTGTTTAGTACTTAGTACCAGG - Intergenic
1060133155 9:121124984-121125006 CTGGATACGCACTATGTGCCAGG - Intronic
1060573546 9:124666755-124666777 CTTGTTTATTGCTGTGTGCCTGG - Intronic
1062068134 9:134539928-134539950 TTTGCTCAGCACTGTGTGCCAGG + Intergenic
1187980346 X:24749847-24749869 CTGTTTTAGTACTATGTGCATGG + Intronic
1189599254 X:42604522-42604544 CTTGTTTGTCACTATTTCCCTGG + Intergenic
1189747040 X:44179914-44179936 TTTGTTGAGTACTGTGTGCCAGG + Intronic
1194973659 X:100371790-100371812 CTTGATAAACACTTTGTGCCAGG - Intronic
1195676638 X:107511854-107511876 CTGGCTTAGCATTCTGTGCCAGG + Intergenic
1195919182 X:109965709-109965731 TTTGTTGATTACTATGTGCCAGG - Intergenic
1196798248 X:119519718-119519740 CTTGCCTAGCTCTATGTGTCAGG + Intergenic
1198196522 X:134368548-134368570 CTTGTTTAGCAATTTGAGGCTGG - Intergenic
1199463787 X:148113316-148113338 CTTATATAGCACTATGTGCCAGG + Intergenic