ID: 992401076

View in Genome Browser
Species Human (GRCh38)
Location 5:76411961-76411983
Sequence GCCCCCCATGTGCCACCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992401076_992401080 30 Left 992401076 5:76411961-76411983 CCTGGGGGTGGCACATGGGGGGC 0: 1
1: 0
2: 0
3: 32
4: 231
Right 992401080 5:76412014-76412036 TCTCCATTTTTTTTCTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992401076 Original CRISPR GCCCCCCATGTGCCACCCCC AGG (reversed) Intronic
900147109 1:1163156-1163178 GCCTCCCCTGTGCCAGGCCCGGG - Intergenic
900148054 1:1166916-1166938 GCCCCCCAGGTGCCCACCCCAGG + Intergenic
900375198 1:2351083-2351105 GTCCCCCATGCACGACCCCCGGG + Intronic
900399072 1:2465586-2465608 GCCCGCCACCTGCCACCCGCCGG + Intronic
900567193 1:3339316-3339338 GCCCACCCTGTGCCTCACCCTGG - Intronic
901238822 1:7681213-7681235 GCCCACCACGTGCCAACCCTGGG - Intronic
901323281 1:8351994-8352016 GGCCCCCATCTGCCTCCCCGTGG - Intergenic
901454694 1:9356307-9356329 GCGCCCCAAGTCCCAGCCCCAGG - Exonic
901676464 1:10888731-10888753 GCCCGCCCTGCCCCACCCCCCGG + Intergenic
901841751 1:11958088-11958110 GCCACCCAAGTGCCTCCTCCTGG + Intronic
902234806 1:15050617-15050639 GCCCCAAATGTGCCACCTTCAGG + Intronic
903033200 1:20477710-20477732 GGCCCCCATTTGTCTCCCCCAGG - Intergenic
903037758 1:20505180-20505202 GCCTCCTATGTGCCAGCCCCCGG - Intronic
903392285 1:22972906-22972928 GCGCCACATCTGCCAGCCCCTGG - Intergenic
906671384 1:47657551-47657573 GCCCCGCATGAGCCACTCGCAGG - Intergenic
913565400 1:120068838-120068860 CCGGCCCATGTGCCGCCCCCTGG + Intronic
913632731 1:120724724-120724746 CCGGCCCATGTGCCGCCCCCTGG - Intergenic
914285988 1:146228193-146228215 CCGGCCCATGTGCCGCCCCCTGG + Intronic
914547020 1:148678946-148678968 CCGGCCCATGTGCCGCCCCCTGG + Intronic
914619487 1:149391416-149391438 CCGGCCCATGTGCCGCCCCCTGG - Intergenic
915458188 1:156053980-156054002 GCCCCCCAGGGGCCCCCGCCTGG - Intergenic
916529472 1:165642233-165642255 GCCCACTATGTGCCACTCACTGG - Intronic
917589036 1:176458368-176458390 ACCCCCCATGTACCATCCCATGG + Intergenic
920206000 1:204292589-204292611 GCCCCCCATTTCCCTCACCCTGG + Intronic
922790809 1:228309825-228309847 GCCCCCCATCTCCCTCCCGCAGG - Intronic
1062788623 10:286166-286188 GCCCTCCATCTGCCACACACCGG - Intronic
1064347758 10:14548310-14548332 GGCCTCCCTGTGCCTCCCCCTGG - Intronic
1067067048 10:43110154-43110176 GCCCCCCATGAGACCCCCCGGGG - Intronic
1068783210 10:60943871-60943893 GGCCCCCACTTGCCACCCGCTGG + Intronic
1070365369 10:75731777-75731799 GCCACCCATGTGCCAGGCCCTGG - Intronic
1071293020 10:84200956-84200978 TCCACCCATGTGGCAGCCCCTGG - Intronic
1071462301 10:85910647-85910669 ACCCCCCATCTGCCACCCAAAGG - Intronic
1072546343 10:96442317-96442339 GCCCCCCTTCCACCACCCCCAGG - Intronic
1073262275 10:102199667-102199689 GCACCCCAAGAGCCACACCCTGG + Intergenic
1073313022 10:102557778-102557800 TCTCCCCATGTGCCACCACTGGG + Intronic
1073328411 10:102656005-102656027 GCCCCCCCTGAGCCTCCCCCAGG - Intronic
1073499283 10:103921271-103921293 GCCCCCCACCTGCCATCCCTGGG - Intergenic
1075002403 10:118808479-118808501 GTCCTCCAGGAGCCACCCCCAGG + Intergenic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077222048 11:1422149-1422171 GCCCCCCATGAGCCCCTCACGGG + Intronic
1077310961 11:1888992-1889014 GCACCCCATGTGCCCTTCCCAGG + Intronic
1078175259 11:8964976-8964998 GCTCCCCATGTGCCTCCCCTTGG + Intronic
1079689875 11:23405602-23405624 GGCTCCCAGGTGCCAGCCCCAGG - Intergenic
1081583048 11:44365617-44365639 GCCTCCCGTGTGCCAGGCCCTGG + Intergenic
1084117270 11:67049639-67049661 GCCCCACCCCTGCCACCCCCAGG - Exonic
1084438631 11:69158096-69158118 GATCCCCATGTCCCACCCCTGGG + Intergenic
1085532754 11:77201647-77201669 CCCACCCATCTGCCACCCCCAGG - Intronic
1088826663 11:113500992-113501014 GCCCTCCAGGTGCCACCAGCAGG - Intergenic
1089090375 11:115869667-115869689 TCCCCACATGTGCCACCTCCAGG - Intergenic
1091690990 12:2597320-2597342 GTCCCCCTTGTGCCAGCACCAGG + Intronic
1091809603 12:3384941-3384963 GCCCCCCACCCGCCACACCCAGG - Intronic
1092027695 12:5256823-5256845 GCCCACCATGTGCCAGACACAGG + Intergenic
1092332737 12:7600584-7600606 GCACCCCAAGGGCCACACCCTGG - Intergenic
1092446719 12:8564754-8564776 GCCCCGCAGGTGCCGCCCCGAGG + Intergenic
1095097690 12:38157025-38157047 GCATCCCATGTGCCATCTCCGGG + Intergenic
1096783063 12:54001769-54001791 GCCCCCCTCCTGCCAGCCCCAGG - Intronic
1097187262 12:57202557-57202579 GCCCCGCATGAGCCCCTCCCAGG + Intronic
1102677654 12:114669141-114669163 ACCCCCCACCCGCCACCCCCTGG - Intergenic
1103836735 12:123827507-123827529 GCCCCCTCTGTCCCACCCACAGG - Intronic
1108567841 13:51718928-51718950 GCCCCACTTGTGCCAACCCAAGG - Intronic
1112172658 13:96990515-96990537 ACCTTCCATGTGCCAGCCCCTGG - Intronic
1113508070 13:110830821-110830843 GCCACGCAGGAGCCACCCCCCGG - Intergenic
1113885544 13:113656810-113656832 GACTCCCATGTGCCGCCTCCTGG - Intronic
1113959570 13:114119098-114119120 GCCCTCCATGTGCCCTTCCCAGG - Intronic
1113960612 13:114123735-114123757 GCCCCGCATGGCCCACCCCGTGG - Intronic
1115873565 14:37835057-37835079 GGCCCCCATGTGCTACCTCAGGG - Intronic
1119706954 14:76788971-76788993 GCCCCCCTTCTGCCTCTCCCAGG + Exonic
1121275832 14:92666964-92666986 GGCCCCCACGTCCCACCACCTGG - Intronic
1123935414 15:25191725-25191747 TCCACCCAGGTGCAACCCCCTGG + Intergenic
1124071458 15:26396785-26396807 ACCCCACCTGTGCCAGCCCCTGG + Intergenic
1125499450 15:40230057-40230079 GCCTCCCATGTGCCTTGCCCTGG - Intergenic
1129461922 15:75703966-75703988 GGCTCCCATCTTCCACCCCCTGG - Intronic
1129739880 15:77985080-77985102 GCCACCCATGTGCCCCCGCCAGG + Intronic
1132032483 15:98450175-98450197 GCTCCCCAAGAGCCACCCCTGGG + Intronic
1132691066 16:1182180-1182202 GCCTCCCACCTGCCACCCACCGG - Intronic
1132744301 16:1430371-1430393 GCCCCCCATTTCCCACCCCAGGG + Intergenic
1134018992 16:10908377-10908399 GCCCGCCATGTGCCAGTCACTGG + Intronic
1135259673 16:20970025-20970047 GCCCCCATTGTGCCAGGCCCTGG - Intronic
1136450912 16:30353849-30353871 GCCCAGCATCTGCCACTCCCAGG + Intronic
1137608390 16:49802296-49802318 TCCCTCCCTGTGCCAGCCCCAGG + Intronic
1139428929 16:66900788-66900810 GCCCCCACTCTCCCACCCCCCGG + Intergenic
1139671146 16:68493076-68493098 ACCCCCCATCTGCAACTCCCAGG - Intergenic
1139699262 16:68697421-68697443 GCCCCCCAGGTGCAATCACCTGG - Intronic
1141439387 16:84019891-84019913 TGACACCATGTGCCACCCCCTGG + Intronic
1141697145 16:85625502-85625524 GCCCCCCAGGTGACACCCCTGGG + Intronic
1141756414 16:85994205-85994227 GCTTCCCGTGTGCCAGCCCCTGG + Intergenic
1142189739 16:88712411-88712433 GCCCCCCAGGGGTCACCTCCGGG - Intronic
1143615853 17:8048659-8048681 GGCCCCCATGTGCCTCTCCTGGG + Exonic
1147810659 17:43167576-43167598 ACACCCCAGGTGCCACACCCTGG - Intergenic
1148357605 17:46986124-46986146 CCCCCCCTTGCCCCACCCCCAGG - Intronic
1149664766 17:58357902-58357924 GCCCTCCCTGAGCCAGCCCCTGG - Exonic
1151975424 17:77481376-77481398 GCACCACATCTGCCTCCCCCTGG - Intronic
1152699785 17:81813149-81813171 GCCCCACGTGTTCCAACCCCCGG - Intronic
1152736037 17:81997220-81997242 GCCCTCCATGCACCACCCCAGGG - Intronic
1152747601 17:82048559-82048581 GCCCCCCCTCTCCCAGCCCCTGG - Exonic
1152754651 17:82082205-82082227 GCCCCCAACGTCCCATCCCCAGG + Intronic
1154324330 18:13379288-13379310 GTCCCCCATGGGGCACCCCCAGG + Intronic
1154325432 18:13387528-13387550 GCCGCCCAGGTGCCACACCCAGG + Exonic
1156370112 18:36465487-36465509 GCCCCTCCTGTACCAACCCCTGG - Intronic
1157319650 18:46624329-46624351 CCCCCTCATCTCCCACCCCCAGG - Intronic
1157502942 18:48203657-48203679 GCCCCCACTGCCCCACCCCCTGG + Intronic
1158485331 18:57861234-57861256 GCCCCCCAGGCTCCACCCCCTGG + Intergenic
1159505420 18:69329058-69329080 GCCTCCCATATTCCACCCTCAGG - Intergenic
1161261180 19:3338691-3338713 GCCCACCCTGTGCCACCCTGGGG - Intergenic
1161487106 19:4542538-4542560 CCCCCACCCGTGCCACCCCCAGG + Intergenic
1161723216 19:5914939-5914961 GCCCCCCATGTCCCAGGCCCGGG + Exonic
1161967617 19:7557015-7557037 GCCCCCACTGTGCGACCCCAAGG + Intronic
1161967658 19:7557217-7557239 GCCCCCGCTGTGCGACCCCAAGG + Exonic
1162181331 19:8871155-8871177 GTCCCCCAAGTGCCCCCACCAGG + Intronic
1162762671 19:12897681-12897703 TACCCTCATGTGCCACTCCCAGG + Exonic
1163152754 19:15424751-15424773 GGCCCCCGGGTGCCAGCCCCAGG + Exonic
1163552122 19:17971291-17971313 GTCCCCCATGTGCCAGGCCTGGG - Intronic
1163715146 19:18868971-18868993 CCCGCGCCTGTGCCACCCCCTGG - Exonic
1163762703 19:19146077-19146099 GCCCACGCTGTGCCATCCCCTGG - Intronic
1163782221 19:19256599-19256621 ACCCTCCATGCTCCACCCCCAGG - Exonic
1163843170 19:19624036-19624058 GCACCCCATCTGACTCCCCCAGG + Exonic
1164540015 19:29115295-29115317 GCCCCCCATATTCTACCCCCTGG + Intergenic
1164892600 19:31837626-31837648 GACCTCCATGTGCCTTCCCCAGG + Intergenic
1164907843 19:31981994-31982016 ACCACCCATGTGCCAACCCCTGG - Intergenic
1165421411 19:35723811-35723833 GCCCCCCAGCTCCCGCCCCCCGG - Exonic
1165896569 19:39145226-39145248 AGCCCCCAGGTGCCTCCCCCAGG + Intronic
1167134857 19:47610011-47610033 GCCCCCCATCTCCTACCCCTCGG + Intronic
1168062102 19:53898781-53898803 GCCCCCCAAGGACCCCCCCCCGG - Intronic
925194712 2:1913697-1913719 GACCCCCGTGTGCCATCCCCAGG - Intronic
925420045 2:3704113-3704135 GCCCCCCAGGTGTCCTCCCCAGG + Intronic
926093648 2:10066286-10066308 GCACCCCGTGTGTCACCTCCAGG + Intronic
926093664 2:10066341-10066363 GCACCCCGTGTGTCACCTCCAGG + Intronic
927343852 2:22013846-22013868 GTCCTCCATATGCCACCCCATGG - Intergenic
928215374 2:29356953-29356975 GACCCCCAAGTCCCACCCTCTGG + Intronic
929561771 2:42960687-42960709 CCTCCCCATGTCCCACCTCCTGG + Intergenic
932430529 2:71671451-71671473 GCGCCCCCCGTGGCACCCCCAGG + Intronic
934686375 2:96325125-96325147 GTGCCCCATTTGCCACCCCAGGG + Intergenic
937094537 2:119226790-119226812 GCCTCCCATGTGCCAGCATCCGG + Intronic
943806108 2:192128921-192128943 GCACCACATGTGCCACACACTGG - Intronic
946796694 2:223362079-223362101 GCCACCCAGGTCCCACCCCAGGG + Intergenic
947140063 2:227012373-227012395 GCCAGCCGTGTGCCAGCCCCAGG + Intronic
947624035 2:231608313-231608335 GCCCCTCCTGTGCCTTCCCCCGG + Intergenic
947740344 2:232481940-232481962 GGCCTCCCTGTGCCACCTCCTGG - Intronic
947748872 2:232522776-232522798 GCGCCCCGTGTGCCTGCCCCAGG + Exonic
948207296 2:236168846-236168868 GCCCCTCCGGAGCCACCCCCGGG + Intergenic
948527610 2:238581253-238581275 GCCTCCCATGTTCCAGCCACAGG - Intergenic
948612853 2:239180760-239180782 GCCCCCCATGGCCCACCCCGAGG + Intronic
948759170 2:240179837-240179859 GCCCCACCTGTGCCAGCCCTAGG + Intergenic
949041056 2:241850156-241850178 GCCCCCCATGTGCCCACCCTGGG - Exonic
1168853730 20:994284-994306 GCTCCCCAGGGTCCACCCCCAGG + Intronic
1172205519 20:33160303-33160325 GCCTTCCTTGTGCCACCCTCAGG - Intergenic
1173655877 20:44700024-44700046 GCTCACCATGTGCCAAGCCCTGG + Intergenic
1173904066 20:46613172-46613194 GACCCCCAGGCCCCACCCCCAGG - Intronic
1175654384 20:60755853-60755875 TCCCTCCCTGTGCCACTCCCAGG - Intergenic
1176234341 20:64047366-64047388 TCCCCTCCTGTCCCACCCCCAGG - Intronic
1178493241 21:33067599-33067621 GCTCCCCATTTCCCACCCACAGG - Intergenic
1179800821 21:43810824-43810846 GCCCTCTCTGTGCCTCCCCCAGG + Intergenic
1182423168 22:30258184-30258206 GCACCCCATGTCCCAGCCCCTGG + Intergenic
1183719379 22:39553423-39553445 TCCCTCCATAGGCCACCCCCCGG - Intergenic
1183744527 22:39685289-39685311 GCCCCCCACCTCCCAACCCCGGG - Intronic
1184109352 22:42385743-42385765 GCCCACCCTGTGCCAGGCCCTGG - Intronic
1184293842 22:43511732-43511754 GCTCCCCATGTCCCTCCCTCTGG - Intergenic
1184355260 22:43975335-43975357 GCCCAGCATGGGACACCCCCTGG + Intronic
1184422283 22:44389212-44389234 GTCCCACCTCTGCCACCCCCTGG - Intergenic
1184593801 22:45502680-45502702 GCCCCCTCTGTGCCCCCTCCGGG + Intronic
1185313947 22:50170724-50170746 GCCCCCCATGCACCACCTCCTGG + Exonic
1185319804 22:50195341-50195363 GCCCCCCCGGTACCACACCCAGG + Intronic
950581648 3:13866198-13866220 GCCCTCCATGTGCCAGGCACTGG + Intronic
951625950 3:24663252-24663274 GAGCCCCATGGGCCTCCCCCAGG - Intergenic
952667362 3:35922746-35922768 GCCCTCTCTGTGCCATCCCCAGG - Intergenic
952892796 3:38054496-38054518 GGGCCCCTTGTGTCACCCCCTGG - Intronic
953930534 3:47003631-47003653 GTCCCCCACCTGCCACCCACTGG - Intronic
954294427 3:49666227-49666249 GCCCAGCATCTGCCAGCCCCAGG - Intronic
954414343 3:50385676-50385698 GCCACCCATCTGCCCACCCCTGG + Intronic
954563391 3:51578136-51578158 TCCCCCCCTGCCCCACCCCCTGG + Intronic
954582748 3:51711888-51711910 GCACCCCATCTCCCACCCTCAGG - Intronic
954601520 3:51874305-51874327 GTCCCCCCTCTGCCACCCACAGG + Intronic
956870536 3:73412913-73412935 GACCCCCATGTGTCTCACCCTGG - Intronic
960861090 3:122154310-122154332 CACCCCCATGTGCCACCTGCAGG + Intergenic
961906043 3:130264147-130264169 GCCCCCCCTGGGCCACGCCCTGG + Intergenic
966220642 3:177547720-177547742 GCCAGCCATGTGCCAACCACTGG - Intergenic
966684781 3:182682418-182682440 GGGCCCCAAGTGCCGCCCCCAGG - Intergenic
968182872 3:196610118-196610140 GCCCCCCAGGTCCTACCCCCAGG - Intergenic
968433005 4:569907-569929 CACCCCCATGTGTCACCCTCAGG - Intergenic
968705620 4:2076095-2076117 GCCCCTCAGGTGCCCCTCCCAGG + Intronic
969435866 4:7189049-7189071 GGGACCCATGTGCCACTCCCAGG - Intergenic
975612247 4:76214133-76214155 GCCTCCCATGGGCCACGCGCTGG + Intronic
980157929 4:129129378-129129400 GCACCCCAGGTGTCACCACCGGG + Intergenic
982133169 4:152248089-152248111 ACCCCTCATGTGCCAGCACCTGG + Intergenic
982288221 4:153756636-153756658 GCCTCCCATGTGCCAGCCACTGG + Intronic
985480870 5:109473-109495 CACCCCCAGGTGCCACACCCTGG + Intergenic
985589645 5:757869-757891 GGCCCCCATGTGAGTCCCCCAGG - Intronic
985896236 5:2751398-2751420 GCCCACCATGTCCTACCCGCAGG - Exonic
992401076 5:76411961-76411983 GCCCCCCATGTGCCACCCCCAGG - Intronic
1001329733 5:170753908-170753930 GCCCTCTTTGTGCCACCCCATGG + Intergenic
1001599498 5:172919792-172919814 GCCCTCCATGTGCCTTCCACAGG - Intronic
1001600279 5:172923941-172923963 GGCCCCAATGTTCCGCCCCCTGG + Intronic
1001651306 5:173318071-173318093 GCCCCCCGAGCGCCAGCCCCAGG - Exonic
1002072007 5:176684537-176684559 GCCCCGTATGTACCACCCCATGG - Intergenic
1002105989 5:176879642-176879664 GCCCCCCCTGGCCCACCCCAGGG - Intronic
1003571680 6:7260404-7260426 GCCCACCATGTCCCATCTCCTGG + Intergenic
1003625034 6:7733567-7733589 GCCCCCCAGGTGACACCCTGCGG - Intronic
1005840756 6:29743352-29743374 GCTCCCCATGGGCCTCCTCCAGG - Intergenic
1007787691 6:44290692-44290714 GACACCCATGGGCCACACCCAGG + Intronic
1013288314 6:108699067-108699089 CCCCTCCACGTTCCACCCCCTGG + Intergenic
1018708452 6:166479571-166479593 CCCCACCTTGGGCCACCCCCTGG - Intronic
1019116858 6:169772065-169772087 GTCCCTCCTGTGCCACCACCTGG + Intronic
1019707153 7:2502239-2502261 GCCCCCCACATCCCACCTCCAGG - Intergenic
1019712606 7:2524456-2524478 GGCCCCCATCCCCCACCCCCAGG + Intronic
1021963261 7:25893521-25893543 GCCCCTAATGTGCCAGTCCCTGG + Intergenic
1022502240 7:30889100-30889122 GCCTCCCTTCTGCCACCCTCTGG + Intronic
1026953857 7:74364552-74364574 GCCCCCCATCTGCCCTGCCCTGG - Intronic
1027604817 7:80287656-80287678 GCCACCCTTCTGCCAACCCCAGG + Intergenic
1028346340 7:89788740-89788762 CCTCCCCTTGTCCCACCCCCCGG + Intergenic
1029444935 7:100606578-100606600 GCCCCCCAAGTCCCAACCTCCGG + Exonic
1030335777 7:108324266-108324288 TCTACCCATGTGGCACCCCCAGG - Intronic
1030680478 7:112428568-112428590 GCCACCCAAGTGAGACCCCCAGG - Intronic
1034528062 7:151678561-151678583 GCCTCCCAAGTGCCAGCCCGGGG - Intronic
1034800386 7:154052280-154052302 GCCACCCAGGTGCCAGTCCCGGG + Intronic
1035133097 7:156674243-156674265 GCCCTTTATCTGCCACCCCCCGG + Intronic
1037819883 8:22130492-22130514 GCTCCCCATGGGCCAGCTCCGGG + Exonic
1038312537 8:26455533-26455555 GCCCCCCAATTATCACCCCCTGG - Intronic
1041759372 8:61347455-61347477 GCCCCCCACATGCCAACCCCTGG - Intronic
1044640962 8:94381216-94381238 GCACCCCATATGCCAGCCCAAGG + Intronic
1044866748 8:96578681-96578703 GCCCCCTGTGTGACAGCCCCAGG + Intronic
1045554369 8:103201305-103201327 ACCCCTCATGTGCAACCCCTGGG + Intronic
1047497169 8:125416701-125416723 GCCCCCCATGGACCAGCCCCTGG - Intergenic
1047561436 8:125991481-125991503 CCCTCCCAAATGCCACCCCCCGG + Intergenic
1047588929 8:126305163-126305185 GCACTCCATGTACCACCTCCTGG - Intergenic
1048901200 8:139039609-139039631 GACCCCCATCTCCCACCTCCAGG + Intergenic
1049169482 8:141150164-141150186 GCCTCCCACGTGCCAGCACCCGG + Intronic
1049201679 8:141343529-141343551 GGCCCCCATGGGCCATCCCTGGG + Intergenic
1049237872 8:141521597-141521619 GCCCTCCATCTGCCAGCTCCTGG - Intergenic
1049688317 8:143948121-143948143 GGCCCCCATGGGCCCCACCCAGG + Intronic
1051542327 9:18233837-18233859 GCCTCTCATGAGCCACCCCAGGG - Intergenic
1053313286 9:37032851-37032873 GGTCCCCATGTGCCTCCCACAGG - Intronic
1057823331 9:98352193-98352215 GCCACCCAGGGGCCAGCCCCAGG - Intronic
1061289254 9:129641596-129641618 GCCTGTCCTGTGCCACCCCCCGG - Intronic
1061373872 9:130212854-130212876 GCCACCCATCTGCCACCGGCTGG - Intronic
1061419713 9:130466621-130466643 GACCCCCATGGGCCCCTCCCAGG + Intronic
1061511992 9:131067225-131067247 GCCCACCATGTGCCACCCTGGGG - Intronic
1061644943 9:131993571-131993593 GCTCCCCATGTGCCCCCACTCGG - Intronic
1061793533 9:133071171-133071193 GCCACCCCTGTGCCCCCCACAGG + Exonic
1061793573 9:133071270-133071292 GCCCCCCCCGTGCCGCCCACGGG + Exonic
1061793589 9:133071303-133071325 GCCCCCCCCGTGCCGCCCACGGG + Exonic
1061793605 9:133071336-133071358 GCCCCCCCCGTGCCGCCCACGGG + Exonic
1061793621 9:133071369-133071391 GCCCCCCCCGTGCCGCCCACGGG + Exonic
1061793637 9:133071402-133071424 GCCCCCCCCGTGCCGCCCACGGG + Exonic
1061793653 9:133071435-133071457 GCCCCCCCCGTGCCGCCCACGGG + Exonic
1061793669 9:133071468-133071490 GCCCCCCCCGTGCCGCCCACGGG + Exonic
1061793683 9:133071501-133071523 GCCCCCCCCGTGCCGCCCACGGG + Exonic
1061793713 9:133071567-133071589 GCCCCCCCCGTGCCGCCCACGGG + Exonic
1061793757 9:133071666-133071688 GCCCCCCCTGTGCCCCCCACGGG + Exonic
1061882269 9:133574323-133574345 GCCCCCTGTGTGCCAGCCCCTGG - Intronic
1062383249 9:136297882-136297904 GCCCCCCACGTGGCTACCCCGGG + Intronic
1062474083 9:136719017-136719039 GAGCCCCATGTGCCACCCTCCGG - Intronic
1203790067 EBV:146553-146575 GCCACCCCTGTGCCACGCCCTGG + Intergenic
1185461406 X:334314-334336 GCTCCCCACGTGCCACCACCGGG - Exonic
1185747306 X:2583655-2583677 GCCCCCCCTGTACCCCCTCCAGG - Intergenic
1191104945 X:56766998-56767020 GACCTCCATGTGCCATCCCAAGG + Intergenic
1191109366 X:56793123-56793145 GACCTCCATGTGCCATCCCAAGG + Intergenic
1191110884 X:56802563-56802585 GACCTCCATGTGCCAGCCCAAGG + Intergenic
1192844408 X:74890827-74890849 TCCTCCCGTGTGCCACTCCCTGG - Intronic
1195643836 X:107206571-107206593 GCCCCCCACCTGCCAACCTCCGG - Intergenic
1196815819 X:119664947-119664969 GCCCCAGATGTGCCTCCCCACGG + Intronic
1197708028 X:129647886-129647908 GGCCCCCAAGTGCCCACCCCCGG - Exonic
1198020425 X:132651862-132651884 GCCAGTCATATGCCACCCCCTGG - Intronic
1200684075 Y:6244832-6244854 TCACCCCATGTGCCTCCTCCTGG + Intergenic
1201048560 Y:9909554-9909576 TCACCCCATGTGCCTCCTCCTGG - Intergenic