ID: 992401135

View in Genome Browser
Species Human (GRCh38)
Location 5:76412817-76412839
Sequence CTTCCATCCCCTGTGGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992401133_992401135 10 Left 992401133 5:76412784-76412806 CCATGCAAACATTAAATGTTGAG 0: 1
1: 0
2: 1
3: 16
4: 254
Right 992401135 5:76412817-76412839 CTTCCATCCCCTGTGGAACCTGG 0: 1
1: 0
2: 2
3: 15
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992401135 Original CRISPR CTTCCATCCCCTGTGGAACC TGG Intronic
900345645 1:2209065-2209087 CTTTGCTCCCCTGGGGAACCCGG - Intronic
900394579 1:2447946-2447968 CCTCCCTCCCCTGCGGTACCAGG + Intronic
901913207 1:12477845-12477867 TTCCCATCTCCTGTGGAACCTGG + Intronic
902809309 1:18879348-18879370 CTTCAAACACCTGTGGAAGCAGG - Exonic
903713507 1:25345064-25345086 CTTCCCTCCCCTGTTGATCAGGG + Intronic
905323060 1:37131309-37131331 CCTCCATGCCCCGTGGAACTTGG + Intergenic
905558099 1:38903599-38903621 CTTCCAACCCATGTTGAACAAGG - Intronic
905794634 1:40808644-40808666 CTTCCTGTCCCTGTGGAAGCTGG + Intronic
906108733 1:43309544-43309566 CGTCCATTCCCTGTGGACCTAGG - Intronic
906165127 1:43680417-43680439 CTTCCACCTCCTTTGGAACTTGG + Intronic
907490299 1:54805137-54805159 CTTCCAGCCCATGGTGAACCTGG - Intergenic
907947632 1:59150180-59150202 CTTCCACCACCAGTGGAACTGGG + Intergenic
911606279 1:99909179-99909201 CTTCCACCCCCAGTGGAAGCAGG - Intronic
911635913 1:100236211-100236233 CCTCCATCTCCTGAGGAAGCTGG + Intronic
912223882 1:107709045-107709067 CTTCCATCTCCTCTGGTAACTGG - Intronic
912329908 1:108810154-108810176 CTTTCATCCCCTGTGGTATGGGG - Intergenic
913056868 1:115170159-115170181 CTTCCATTCCCAGTGGAATAAGG + Intergenic
916169843 1:161993692-161993714 CTTCCATTCCCTGCCCAACCTGG + Intronic
916202762 1:162287646-162287668 CTCCCATCACCTGGGGTACCAGG - Intronic
917498216 1:175562024-175562046 CTGCCATCACCTGTGGAAGAAGG + Intronic
919414492 1:197290638-197290660 CTTTCATCCCCTGTGTTACCTGG + Intronic
921478099 1:215633929-215633951 CATCCATCCTCTGTGGCACAGGG + Intronic
922578128 1:226676990-226677012 CTTCCATCCCCTGAGCACCTGGG + Intronic
1063386690 10:5620382-5620404 CCTCCTTCCTCTGTGGATCCTGG - Intergenic
1067528851 10:47055839-47055861 CCTCCAGCCCCTCTGGATCCTGG + Intergenic
1072626617 10:97116420-97116442 CTTCCCTCCTCTGGGGAAGCTGG - Intronic
1073140432 10:101243548-101243570 CTTTCCTTCCCTGTGGCACCAGG - Intergenic
1073294689 10:102432040-102432062 CTCCCAGCCCCTGTGAAGCCCGG + Intronic
1074360234 10:112819915-112819937 CTCCCATCCCCAGAGGGACCAGG + Intergenic
1074752913 10:116604012-116604034 CTTCCATCTCCTGTGCAGGCTGG + Exonic
1076049247 10:127319665-127319687 ATTCCATCCCCTGTGGGCCATGG + Intronic
1076345004 10:129773814-129773836 CTTCCATCCCTGGTGAAGCCAGG - Intergenic
1076939274 10:133590799-133590821 CGTCCAGCCCCTGTGGAGCAGGG - Intergenic
1077080498 11:722714-722736 CTCCCAGCCGCTGTGGAACTTGG - Exonic
1077191359 11:1257128-1257150 CTTCCATCCCGGGGGGAAGCAGG + Intronic
1077211378 11:1372325-1372347 CCTCCCTCCCCTGTGGGAACCGG + Intergenic
1077278801 11:1732674-1732696 CTTCCATACCCTGGGGACCGGGG - Exonic
1077415113 11:2421191-2421213 CTTCCATCCCCACAGGAGCCTGG - Exonic
1078860887 11:15245177-15245199 CCTCCCTCCCCTGTGCAACCAGG - Intronic
1083167158 11:60897627-60897649 CTTCCATGCCCTGTGGCATTGGG - Intronic
1086351047 11:85943432-85943454 CTTCCATTCCCAGTGGAGCATGG + Intergenic
1091648633 12:2292831-2292853 CTCCCATGCCCTGCGGCACCAGG + Intronic
1095694831 12:45132643-45132665 CTTCATACCCCAGTGGAACCTGG + Intergenic
1097904305 12:64904379-64904401 TCTCCATCTCCTCTGGAACCTGG - Intergenic
1100263552 12:92954643-92954665 GCTCCATCCCATGTGGAACAGGG + Intergenic
1100475151 12:94928611-94928633 CTTCGCTTCCCTGTGCAACCTGG - Intronic
1101318308 12:103649966-103649988 CTTCCATCACCTGGGGAAGCTGG - Intronic
1102398209 12:112605739-112605761 TTTCCATCTCCTGTGGAACTGGG + Intronic
1102458565 12:113086433-113086455 CTTCCAGACCCTGTGTGACCTGG - Intronic
1103262258 12:119597647-119597669 CTACCACCCCATGTAGAACCAGG + Intronic
1103718023 12:122957393-122957415 CTTCCCTCCTCTGTGCAACAAGG - Intronic
1104558001 12:129819457-129819479 CCTCCATCCCTGGTGGAACTGGG - Intronic
1106669919 13:31893907-31893929 CTTTCATAGCCTGTGTAACCAGG + Intergenic
1108201798 13:48051375-48051397 GTTCCTTCCTCTGTGAAACCTGG + Intergenic
1110209463 13:72954511-72954533 CCTCCATCCCCGCTGGAATCTGG + Intronic
1112418104 13:99221680-99221702 CTACCATCCCAGGTGGAACAGGG - Intronic
1117085369 14:52195459-52195481 CTTCCTAGCCCTGTGGAACTTGG + Intergenic
1120721881 14:87898234-87898256 CATCCATGACCTGTGGGACCAGG - Intronic
1120747414 14:88164875-88164897 CTTCCCTCCCCAGTGGAGACTGG + Intergenic
1121422482 14:93825138-93825160 CTGCAATACCCTGTGGAGCCAGG + Intergenic
1125514272 15:40309105-40309127 CTTCCTTCCCCTCTGGGGCCTGG + Intergenic
1127328288 15:57916234-57916256 TTTGCAACCCCTGTGGAACAGGG - Intergenic
1129255775 15:74333209-74333231 TTTCCATCCCAGGTGGACCCCGG + Intronic
1131777845 15:95822026-95822048 CTTCTGGGCCCTGTGGAACCAGG - Intergenic
1131979187 15:97979207-97979229 CTTCCTTCCCCTGGGGTTCCTGG - Intergenic
1132113625 15:99120177-99120199 CCTCCATGCCCTGTTGAACGTGG + Intronic
1132540388 16:505733-505755 CGTCCATCCCCGTTGGAAGCCGG + Intronic
1133050308 16:3113686-3113708 CTTCCATCTCCTGTGGCCACTGG - Intronic
1133972639 16:10578763-10578785 CCTCCATCCCATGGGGAGCCAGG - Intronic
1138598387 16:58041458-58041480 CCTCCATCCTCGGTGGGACCTGG - Intronic
1140000663 16:71021861-71021883 CTTCCTTCCACTGTGGTTCCTGG + Intronic
1140127261 16:72128494-72128516 CTTCCCTCCCCATTGGCACCTGG - Intronic
1140951520 16:79822973-79822995 CTTCCATCCTCTTTGCAACAGGG - Intergenic
1142141052 16:88473042-88473064 CTGCCGTCCCCCGTGGGACCGGG + Intronic
1144488953 17:15691427-15691449 ATTCCTCCCCCTGTGGAACAAGG + Intergenic
1144912069 17:18690877-18690899 ATTCCTCCCCCTGTGGAACAAGG - Intergenic
1145029658 17:19495137-19495159 GCTCGATCCTCTGTGGAACCAGG - Intergenic
1149485195 17:57037097-57037119 CTTCCATGAGCTTTGGAACCAGG - Intergenic
1152501058 17:80709334-80709356 CTGCCCTCCCCTGTGGCGCCTGG + Intronic
1152641129 17:81449700-81449722 CTCCCATTCCCTGCGGATCCTGG + Intronic
1157286953 18:46383356-46383378 CTTACATCCCCTTTCGAACCAGG - Intronic
1157310165 18:46546795-46546817 CTTCCCTCCCCTGTGGGCTCTGG - Intronic
1157407308 18:47432957-47432979 CTGGCATCCCCTGTGAAATCAGG - Intergenic
1160860235 19:1234528-1234550 CTCCCGTCCCCCGAGGAACCGGG + Intronic
1161178094 19:2859775-2859797 CATCCATCCCTTGTGGAAGGAGG - Exonic
1162536777 19:11267270-11267292 CCTCTCTCCCCTGTGGAAGCTGG + Intergenic
1164324299 19:24178609-24178631 CATCCTTCCCCTGTGGAATGAGG - Intergenic
1164749030 19:30637383-30637405 TGTCCATCCCCTGTGGAAGGAGG + Intronic
1167143870 19:47670859-47670881 CTTCCTCCCCCTGTGTCACCAGG - Intronic
926168808 2:10537914-10537936 CATCCTTCCCATGTGGGACCTGG + Intergenic
926534786 2:14098318-14098340 CTTGGATCACCTGAGGAACCAGG - Intergenic
926690858 2:15732445-15732467 CTTCCTTCCTCTTTGGAAACTGG - Intronic
927640090 2:24840658-24840680 CTTCCAGCCTCTGCGGGACCCGG - Intronic
929586861 2:43121784-43121806 CTTCCATCCCATCTGGAACCAGG - Intergenic
931789973 2:65656166-65656188 CTTCCATCCGATGAAGAACCTGG - Intergenic
932492569 2:72131517-72131539 TTCCCATCCCCTGCTGAACCAGG - Exonic
932954691 2:76337606-76337628 CTTCCCTCACCTGTGGAGCCTGG + Intergenic
933291415 2:80442482-80442504 CCCCCATCCTCAGTGGAACCTGG + Intronic
933933579 2:87180602-87180624 CTTCTATCCCCTGGGGAGCCAGG + Intergenic
935375023 2:102387216-102387238 ATTCCATCCCATGTGGAAATCGG + Intronic
936046895 2:109195372-109195394 CTTCCCTGCCCTCTGGGACCAGG + Intronic
936359532 2:111784842-111784864 CTTCTATCCCCTGGGGAGCCAGG - Intronic
938097469 2:128473122-128473144 CTTCCATCCCCGCAGGACCCAGG + Intergenic
941077145 2:161018651-161018673 TTGCCATCCCCTGTGGAAAAAGG + Intergenic
942358468 2:175145511-175145533 CTTGTATAGCCTGTGGAACCAGG + Intronic
942431037 2:175911813-175911835 CTTACATCCTGTGTGGAACAAGG - Intergenic
945923486 2:215779896-215779918 TCTCCATCCCCAGTGGACCCTGG - Intergenic
948396481 2:237648828-237648850 TTTCCTTCCCCTGGGGAGCCTGG - Intronic
948483378 2:238264288-238264310 CCACCCTGCCCTGTGGAACCAGG - Intronic
948853885 2:240721205-240721227 CCTCCAGCCCCTGTGGCCCCTGG + Intronic
1169922629 20:10751608-10751630 CTTCCATTCCAAGTGGAATCAGG - Intergenic
1173168438 20:40702673-40702695 CCTCCATCCCCTGTGTTTCCTGG - Intergenic
1173338161 20:42130116-42130138 CTTACACCCCCTTTGGAAACAGG - Intronic
1173546669 20:43903209-43903231 CTCCCAGCCCCTGTGGCCCCTGG + Intergenic
1173631759 20:44521704-44521726 CTTCCGTTCCCCGAGGAACCCGG + Intronic
1173851412 20:46220719-46220741 CTTCCAGCTCCTGAGGAACTGGG + Intronic
1174151848 20:48491553-48491575 TTTTCATCCCATGTGGGACCTGG - Intergenic
1178938097 21:36881766-36881788 TGTCCATACCCTGAGGAACCTGG + Intronic
1179102452 21:38366086-38366108 ATTCCATCCCTTGGTGAACCAGG + Intergenic
1179539163 21:42072988-42073010 CACTCATCTCCTGTGGAACCCGG - Intronic
1181541151 22:23573984-23574006 TTCCCATCCCCTGGGGCACCAGG + Intronic
1181694116 22:24584554-24584576 CATCCATCCCCTGTGGTGCATGG - Intronic
1181797227 22:25319346-25319368 TTCCCATCCCCTGGGGCACCAGG - Intergenic
1181966953 22:26663416-26663438 CTACCATCCCCAGTGGACACAGG - Intergenic
949586001 3:5437971-5437993 CTCCCATCCCCTGTGAATGCTGG + Intergenic
949603317 3:5625708-5625730 CTTCCCTCCCCTGTAGCCCCTGG + Intergenic
951010272 3:17669263-17669285 CTTCCCAGCCCTGTGGAACTAGG + Intronic
954802310 3:53194327-53194349 GTTTCCTCCCGTGTGGAACCGGG + Intergenic
961626973 3:128270900-128270922 CCTGCATCTCCTGTGGACCCTGG + Intronic
961869575 3:129977629-129977651 CTTCCATCCCCTCCCCAACCTGG + Exonic
966970948 3:185044922-185044944 CCTCCTTCCCCTCTGCAACCAGG - Intronic
968232240 3:197010905-197010927 CTTCCTTCCCCTGGGGAATGTGG + Intronic
969522668 4:7687600-7687622 AGACCATCCCCAGTGGAACCTGG - Intronic
973029943 4:45325005-45325027 CTTCCATCCTGAGTGGAAACAGG + Intergenic
975429178 4:74267946-74267968 CTTCTATTCCTTGTGGTACCAGG - Intronic
976186530 4:82448116-82448138 CTTCTATCCCCTATCAAACCAGG - Intronic
981570231 4:146143764-146143786 CTTCACTCACCTGTGGCACCTGG - Intergenic
983105427 4:163680622-163680644 CATCCTTCCTCTGTGGAACTAGG + Intronic
983207913 4:164930620-164930642 CTTCCATCCACTGTGGTACCTGG + Intergenic
983210937 4:164957007-164957029 CTTCCATCCACTGTGGTACATGG - Exonic
986496700 5:8349335-8349357 CTTCCATCCCATGGAGAAGCAGG - Intergenic
986516616 5:8571336-8571358 CTGACATCCCCGATGGAACCTGG + Intergenic
986843235 5:11722558-11722580 CTCCCAGGCCCTGTGGAACTGGG - Intronic
990528199 5:56649648-56649670 CCTCCAACCCCTGCAGAACCTGG + Intergenic
992401135 5:76412817-76412839 CTTCCATCCCCTGTGGAACCTGG + Intronic
992636250 5:78728424-78728446 ATTCCATTCCCTCTGGATCCTGG - Intronic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
998948758 5:147370113-147370135 CTGCCATACTCTGTGGAACCAGG + Intronic
1001030787 5:168261282-168261304 ATTTCATCCCCTGCAGAACCAGG + Intronic
1002524600 5:179807976-179807998 CCTCAATCCTCTGTGGAACCAGG + Intronic
1003361376 6:5429384-5429406 CTGCCTTCTCCTGTGGAATCTGG + Intronic
1004238598 6:13898080-13898102 CTGCCATCACCTCTGCAACCAGG + Intergenic
1005947418 6:30604496-30604518 CTTCCAGCCTCTTTGGAGCCAGG - Exonic
1007061190 6:38942362-38942384 CCACCATCCACTGTGGACCCAGG - Intronic
1007941932 6:45789527-45789549 TTTCCATCCTCTCAGGAACCAGG - Intergenic
1014968193 6:127782327-127782349 TTTCCTACCCCAGTGGAACCTGG - Intronic
1016633046 6:146254321-146254343 CTTCCTTCCAGTGTGGAAGCTGG - Intronic
1018423482 6:163660466-163660488 ACTCAATGCCCTGTGGAACCAGG + Intergenic
1023677101 7:42642268-42642290 CTTCCCTCCCCTCTTCAACCAGG - Intergenic
1024302979 7:47902188-47902210 CCTCCCTCCCCTGAGGACCCAGG + Intronic
1024526972 7:50357268-50357290 CTTCCAAGGCCTCTGGAACCAGG + Intronic
1026826427 7:73585022-73585044 CTTCAATCTCCAGTGGTACCTGG - Intergenic
1029907102 7:104103193-104103215 CTACCTTTCCCAGTGGAACCAGG - Intergenic
1030904431 7:115164254-115164276 CTTCCATGACATGTGGAAACTGG + Intergenic
1034880213 7:154757226-154757248 CTCACATCCCCTGAGGAACTGGG + Intronic
1035072787 7:156157314-156157336 CTGGCATCCCGTGTGGGACCTGG + Intergenic
1035723229 8:1808487-1808509 CCTCCATCCCCAGTGGTACCTGG - Intergenic
1036376043 8:8200362-8200384 CTACCATCCCTTGTGGCAGCGGG - Intergenic
1036853485 8:12222776-12222798 CTACCATCCCTTGTGGCAGCGGG + Intergenic
1036874860 8:12465297-12465319 CTACCATCCCTTGTGGCAGCGGG + Intergenic
1037123775 8:15320406-15320428 CTTCCAGCCCCTGTGCAATAGGG - Intergenic
1037359169 8:18054682-18054704 CTAGCATCCCCTGTGCCACCTGG + Intergenic
1042949396 8:74185346-74185368 CTTTCATCCCCTGTGAATTCAGG + Intergenic
1043760943 8:84067329-84067351 CTAACATCACCTTTGGAACCAGG + Intergenic
1043767634 8:84157079-84157101 ATTCCATCCTATGTGAAACCTGG - Intergenic
1049060708 8:140273991-140274013 GTCCCATCCCCTGGGGAGCCGGG - Intronic
1049773241 8:144393359-144393381 CTTCCATCCCCTGCAGATCCTGG - Exonic
1050734880 9:8750773-8750795 CTTACAGGCCCTGTGCAACCTGG - Intronic
1052246867 9:26346953-26346975 CTGCCATCCACTGTGAGACCTGG + Intergenic
1056960165 9:91116490-91116512 CTTCCATGCCCAGAGGAGCCTGG - Intergenic
1059049046 9:110902528-110902550 CTTCCAAGCCATGTGGAACTGGG + Intronic
1060044201 9:120327197-120327219 TTCCCCTCCCCAGTGGAACCAGG - Intergenic
1187201348 X:17136424-17136446 CTTCCAGCCCCTGTTAAGCCTGG + Intronic
1190276253 X:48901452-48901474 CTTCCAACCCCAGAGGAGCCAGG - Intronic
1190402876 X:50056620-50056642 CTTTCATGACCAGTGGAACCAGG - Intronic
1190433767 X:50403416-50403438 CTTCCTCCCCCTGTGTATCCTGG + Intronic
1190566010 X:51731486-51731508 CTTCCCTCTCCTGGGGAAACTGG - Intergenic
1195107731 X:101616932-101616954 CTGCCCTTCCCTGTGGACCCAGG - Intronic
1199663652 X:150079673-150079695 CTACCCTCCTCTGTGGACCCTGG + Intergenic
1200896286 Y:8379347-8379369 CTACAATCCCCAGTGGAATCAGG + Intergenic