ID: 992403615

View in Genome Browser
Species Human (GRCh38)
Location 5:76434347-76434369
Sequence TTGGAGACTCAGAAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1016
Summary {0: 1, 1: 12, 2: 79, 3: 198, 4: 726}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992403615 Original CRISPR TTGGAGACTCAGAAAGAGGA GGG (reversed) Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
900810572 1:4798569-4798591 TTGGACAGGCAGGAAGAGGAGGG - Intergenic
900906015 1:5558207-5558229 GTGGAGAGTCATGAAGAGGAGGG + Intergenic
901259070 1:7857948-7857970 ATGAAGTCTCACAAAGAGGAAGG + Intergenic
902553940 1:17235682-17235704 ATGCAGACTCAGGAAGGGGAGGG + Intronic
902955915 1:19924007-19924029 GTGGAAACTCTGAAACAGGACGG - Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903503250 1:23813920-23813942 TGGGAGACTGAGGCAGAGGATGG - Intronic
903727956 1:25465769-25465791 ATGCAGACTCGGAAAGACGAGGG - Intronic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
903950063 1:26991515-26991537 GTGGAGACTCAGTGAGGGGAAGG - Intergenic
904280355 1:29414370-29414392 TTGGGGACTCAGTCAGAGGGAGG + Intergenic
904287879 1:29464228-29464250 TTGGAGTCTCTGAAGGAGGCAGG - Intergenic
904574795 1:31498421-31498443 TGGGAGACTGAGCAGGAGGATGG - Intergenic
904586963 1:31586005-31586027 ACTGAGACTCAGAAAGAGAAAGG + Intronic
905255088 1:36675512-36675534 TTGGAAGCTCCGAAAGTGGAAGG + Intergenic
905350576 1:37343632-37343654 ATGGAAGCTCAGAGAGAGGAAGG + Intergenic
906187470 1:43872138-43872160 ATGGGGACTAACAAAGAGGATGG + Intronic
906673918 1:47679500-47679522 TTGGAGACACAGGAAGAGGCAGG - Intergenic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
906923754 1:50092216-50092238 TTGGAAACACAAAAAGAGCATGG + Intronic
907639602 1:56173681-56173703 TTAGAGACCCAGAAAAAGGAGGG - Intergenic
907806255 1:57823385-57823407 TTGGACACCGAGGAAGAGGAAGG + Intronic
908771778 1:67603921-67603943 TTGGAGACTCAGAAATGGGGAGG + Intergenic
909990969 1:82222269-82222291 GGGGAGACTCAGAGAGAGAAGGG - Intergenic
910086935 1:83414212-83414234 TTAAAGACTCAGAAAGGGGTGGG + Intergenic
910402255 1:86848891-86848913 TAGCAGACTCAGAAATTGGAAGG + Intergenic
910738487 1:90489193-90489215 TTGGAGACTTGGAGGGAGGAGGG - Intergenic
911457797 1:98148905-98148927 TTAGAGACTCAGAAGGGGAAAGG + Intergenic
911546319 1:99221967-99221989 ATGGACTCTTAGAAAGAGGAAGG + Intergenic
911795329 1:102068738-102068760 TTAGAGATTCAGAAGGGGGAGGG + Intergenic
911946207 1:104112760-104112782 TTGGAGACTCAAAAGGGGGAAGG - Intergenic
912003539 1:104864322-104864344 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
912165924 1:107042130-107042152 TTGTTGATTCAGAAAGAGGTGGG - Intergenic
913057288 1:115174352-115174374 CTGGAAACTCACAAAAAGGAGGG + Intergenic
913487797 1:119349378-119349400 TTGGAAAATCAGAAAGAAAAAGG + Intergenic
913572424 1:120134038-120134060 TTTGAGATTCAGACAGGGGAAGG - Intergenic
913576250 1:120178075-120178097 TTAGAGACTTAGAAGGCGGAGGG - Intergenic
913613589 1:120533027-120533049 TTGAAGACTGAGAAAGTTGAAGG + Intergenic
914409501 1:147412394-147412416 TTGGAGCCCAAGAAAGAGAAGGG - Intergenic
914577483 1:148988224-148988246 TTGAAGACTGAGAAAGTTGAAGG - Intronic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915565123 1:156708661-156708683 CTGGAGACTCAGTGAGGGGAGGG + Intergenic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916902779 1:169247640-169247662 TTGGCGACTCAGAAGAGGGAGGG - Intronic
917410822 1:174758452-174758474 TTGGAGACTCAGAAGGGGAAAGG - Intronic
917478144 1:175386389-175386411 CTGGTGAGTCAGAGAGAGGATGG + Intronic
917505317 1:175622192-175622214 TTGGAGACTCTGAATCTGGAAGG + Intronic
917577414 1:176338431-176338453 TTGGAGACTGAATCAGAGGAGGG + Intergenic
917917569 1:179718878-179718900 CTGGAGACTCCAAAAGGGGAGGG - Intergenic
918002435 1:180510087-180510109 TTAGAGACTCAGCAGGGGGAGGG - Intergenic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
918344921 1:183598750-183598772 TTGAAGACCCAGATAGAGGATGG + Intergenic
918386423 1:184012929-184012951 CTGGAGATTCAAAAAGAAGAGGG + Intronic
918566880 1:185944302-185944324 TTGAAGACTCAGAAGGGAGAGGG + Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG + Intronic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
920548302 1:206837108-206837130 TTGGAGATTAGGAAAGAGAAGGG - Intronic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
921144487 1:212340193-212340215 CTGGATCCTCAGGAAGAGGATGG - Intronic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
921773752 1:219073096-219073118 TTGGAGACTTGGAAGGTGGAAGG - Intergenic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
922504539 1:226118901-226118923 TTGGAGAGCCAGAACAAGGATGG + Intergenic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
922664387 1:227456188-227456210 TTGGAAATTCTGAAGGAGGATGG - Intergenic
922860832 1:228814946-228814968 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923482286 1:234396881-234396903 TGGGGGACTCAGAATGAGAAGGG + Intronic
923880903 1:238103176-238103198 TTAGAGACTCAGCAGGGGGAAGG - Intergenic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
924621992 1:245669971-245669993 TTGGAGACTCCGAAGGGGAAAGG + Intronic
1063281520 10:4634289-4634311 TTGGAGACTGAGAAGGAGGGAGG + Intergenic
1063518552 10:6720322-6720344 TTGGAGACTAGGAAGGACGAAGG - Intergenic
1064002675 10:11676583-11676605 TGGGAGATTCAGGAAGAAGAGGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064245457 10:13664353-13664375 ATGGAGTGTCAGAAAGAGGTTGG + Intronic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064594216 10:16926984-16927006 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1064662825 10:17623423-17623445 GTGGAGACTCAGAAGCAGGGAGG - Intergenic
1064832409 10:19485162-19485184 TTGGAAACTCAGAAAGAGGGAGG + Intronic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065284574 10:24175194-24175216 TTGAAGACTCGGGAAAAGGATGG - Intronic
1065319690 10:24497813-24497835 TTGGAGACTCAGAAGTGGGCAGG + Intronic
1065954569 10:30682545-30682567 ATGGTGACTCAGAAAGATGGTGG - Intergenic
1066526201 10:36282679-36282701 TTTAAGAGTCAGAAAGAGTAGGG - Intergenic
1066597788 10:37071062-37071084 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1066697271 10:38090632-38090654 TTGAAGTCTCAGAAGCAGGAAGG + Intergenic
1066994790 10:42553583-42553605 TTAGAGACTCAGAAGGGGGCTGG + Intergenic
1067010882 10:42712521-42712543 TTGGAGACTCATAAGCAGGGAGG - Intergenic
1067550337 10:47229835-47229857 TTGGAAACTCAGAATCAGGAAGG - Intergenic
1067784394 10:49233229-49233251 TGGGAGACTCAGAATGGGGGAGG + Intergenic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1067968853 10:50945991-50946013 TTAGGGAGGCAGAAAGAGGATGG - Intergenic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1068799293 10:61121359-61121381 TGTGAGACAGAGAAAGAGGAAGG - Intergenic
1069024362 10:63523296-63523318 TTGGAGAATCAGAAAAGGCAAGG + Intronic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1069238285 10:66105859-66105881 GTGGAAACTAAGAAAGAGAAAGG + Intronic
1070103495 10:73411284-73411306 TTAGAGACTCAGAAAGGGGAGGG + Intronic
1070453035 10:76581099-76581121 TGGAAGAGGCAGAAAGAGGAAGG + Intergenic
1070629340 10:78073646-78073668 TTGAAGACCCTGAGAGAGGAAGG - Intergenic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1071187486 10:83060973-83060995 TTTAAGACACAGAAAGAGGGTGG - Intergenic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1071379889 10:85047995-85048017 TTGGAGACCCAGAGAAAGCATGG - Intergenic
1071435965 10:85648506-85648528 ATGGTGACTCAGAGAGAGGGAGG - Intronic
1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG + Intergenic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072324894 10:94288232-94288254 TTGGAGACTCAGAATGAGAGTGG - Intronic
1072872907 10:99139271-99139293 CTGGAGACTCAGAAGCAGAAGGG + Intronic
1073431392 10:103489809-103489831 ATGGAGAGAGAGAAAGAGGAAGG + Intergenic
1073637893 10:105218450-105218472 ATGGAAACTCTGTAAGAGGAGGG - Intronic
1073763605 10:106657442-106657464 TTGGAGAGTCAGAAAGGGTGAGG + Intronic
1073790465 10:106934899-106934921 CTGGAAACTCAGAAAAGGGAGGG + Intronic
1074734847 10:116419596-116419618 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
1075518475 10:123128920-123128942 TTGGAAACTCAGAGAGAGCATGG + Intergenic
1075690424 10:124390261-124390283 CTGGAGGCTCAGAGAGCGGAAGG - Intergenic
1075953427 10:126501898-126501920 TCAGAGACTCAGAAAGGGGAGGG + Intronic
1076347583 10:129790391-129790413 TTAGAGACTCAGAAGCGGGAGGG + Intergenic
1076643518 10:131935336-131935358 TAGGAAACTCAGAGACAGGAAGG - Intronic
1076672137 10:132128504-132128526 TTGGAATCCCAGAAAGAGAAAGG - Intronic
1077894609 11:6444222-6444244 TTATAGACTGAGCAAGAGGAGGG - Intergenic
1078673335 11:13385091-13385113 TTTGAGACTCAGCCAGGGGAAGG + Intronic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1079467799 11:20748563-20748585 TTGGAGACTGAGAAGGCAGAAGG - Intronic
1079812812 11:25016308-25016330 TTACAGACTCAGAAGGGGGAAGG - Intronic
1080047543 11:27825149-27825171 TTAGAGACTCAGAAAGGGCAGGG - Intergenic
1080510706 11:32967310-32967332 TTGGAGACTCAGAAGGGGAGAGG + Intronic
1080536837 11:33230244-33230266 GTGGAGACTCAGAGGGATGAAGG + Intergenic
1080675792 11:34425551-34425573 TTTGAGACTCAGAAGGGGGAGGG + Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1080697371 11:34614350-34614372 TTGCATACTAAGAATGAGGATGG + Intergenic
1080863144 11:36167996-36168018 CGGGAGTCTAAGAAAGAGGAGGG - Intronic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081523108 11:43902093-43902115 TGGGAGGCTAAGGAAGAGGAAGG + Intronic
1081525491 11:43924897-43924919 TAGGAAAGTCAGAGAGAGGAGGG + Intergenic
1081596302 11:44461971-44461993 TTGGAGACTATCAAAGAGAATGG + Intergenic
1081887750 11:46513716-46513738 ATGGAGACTGACAAACAGGAAGG + Intronic
1081906346 11:46672758-46672780 GTGGAGTCGCAGAAAGAGGAAGG + Intronic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082202983 11:49396303-49396325 TTTGAGACTCAGAAGGTGGGAGG - Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082697351 11:56385730-56385752 TTAGAGACTCAGAAAAGGGGTGG + Intergenic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083170784 11:60923000-60923022 TCAGAGACCCTGAAAGAGGAGGG + Exonic
1084475520 11:69386516-69386538 ATGGAGGCTCAGAGAGAGAATGG - Intergenic
1084661387 11:70548543-70548565 TTGGGGACTCTGGAAGGGGAAGG - Intronic
1084851477 11:71944764-71944786 TTGTAGACTGAGTAATAGGAAGG + Intronic
1085912801 11:80848460-80848482 TGACAGACACAGAAAGAGGAAGG - Intergenic
1086652048 11:89303776-89303798 TTTGAAACTCAGAAGGTGGAAGG + Intergenic
1086845091 11:91739005-91739027 TTGATGACTCAGAAGCAGGAGGG + Intergenic
1088276208 11:108088980-108089002 TTGGACTCTCACAAAAAGGAAGG - Intronic
1088553021 11:111033794-111033816 TTGGAGACGCAAAATGGGGAGGG + Intergenic
1088793629 11:113248748-113248770 GTGGCGACTCAGAAGGAGAAGGG + Intronic
1088843765 11:113648122-113648144 TCAGAGATTCAGAGAGAGGAAGG + Intergenic
1089051046 11:115546261-115546283 TGGGAGAGAAAGAAAGAGGATGG - Intergenic
1090269615 11:125376962-125376984 ATAGAGGCCCAGAAAGAGGAGGG - Intronic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091448381 12:557858-557880 TTGGAGACTAGGAATCAGGAAGG - Intronic
1091621565 12:2093137-2093159 TTACAGAGTCAGAAAGAGCAAGG + Intronic
1091918882 12:4288753-4288775 GCAGAGACTCAGAAACAGGACGG - Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092205761 12:6613531-6613553 TTGGGGAGTCTGAGAGAGGACGG + Intergenic
1092614378 12:10203050-10203072 TAGGAGTCTCAGAGAGATGATGG - Intergenic
1092782487 12:11999906-11999928 TGGGAAACTCAAGAAGAGGATGG - Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093012064 12:14117855-14117877 TTGGAGTCCCAGAAGGAGAAGGG + Intergenic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093524297 12:20089869-20089891 CTGGGGACTCCGAAAGAGGCAGG + Intergenic
1093705501 12:22270640-22270662 ATGGAGACTCAGAAAGGTAAAGG + Intronic
1093759374 12:22890286-22890308 TTGGGGACTATGAAAGAGTAGGG + Intergenic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094322101 12:29195858-29195880 ATGGGGACTCAGAAGGACGAGGG - Intronic
1094591267 12:31823214-31823236 TTGGAGACTCAGGAAAAGGTGGG - Intergenic
1095458169 12:42412250-42412272 ATGGAGACTCACAAGCAGGAGGG - Intronic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1096629719 12:52918345-52918367 TTGGAGCCTCAGAAACATGCAGG + Intronic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097477657 12:60078625-60078647 TTGGAGACTCAGAAGGGGATAGG - Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097924736 12:65114866-65114888 GTGGAGATTCAGAAAAATGAAGG + Intronic
1097988445 12:65808931-65808953 CTGGAAACTGAGAAAGAGGATGG - Intergenic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099355119 12:81624812-81624834 TCAGAGACTCAGAAGGGGGAGGG + Intronic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1100292076 12:93225309-93225331 TTGGAGACTAAGAAGAGGGAAGG - Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101132179 12:101700200-101700222 TTGAACACTTAGAAAGAGCAGGG + Intronic
1101214464 12:102566764-102566786 GTGAAGACACAGGAAGAGGATGG - Intergenic
1101399926 12:104378306-104378328 TAGGGGACCCAGAAAGGGGAAGG + Intergenic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101520439 12:105477550-105477572 TTAGAGACTCAGAAAGGGGAAGG - Intergenic
1101831750 12:108263277-108263299 TTCCAGACTCAAAAGGAGGAAGG - Intergenic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1102401347 12:112632355-112632377 TTGGAGACTCAGAAAGATGGAGG - Intronic
1102724327 12:115045909-115045931 TTGGATACTAAGAATGACGATGG + Intergenic
1103105680 12:118222761-118222783 TTGGAGACTCAGAAGAGGAAGGG + Intronic
1103147156 12:118604791-118604813 TTGGAGAGGCAGTGAGAGGAGGG + Intergenic
1104244449 12:127024313-127024335 TTAGAGACTCTGAAGGAGGAAGG + Intergenic
1104638354 12:130451569-130451591 TTGGGGGCTCAGGACGAGGATGG + Intronic
1104809045 12:131609505-131609527 CTAGAGGCTCAGAAGGAGGAGGG - Intergenic
1105046406 12:133007534-133007556 TGGGTGAGTGAGAAAGAGGAAGG + Intronic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1106404449 13:29461799-29461821 TGGGATACTCAGGAAGAGGTTGG + Intronic
1106456803 13:29934981-29935003 CTGCAGGCTCAGAAAGAGGCAGG + Intergenic
1106772013 13:32970901-32970923 TTGGAGACTCAGAGCAGGGAGGG - Intergenic
1107175812 13:37396540-37396562 TTGGCAACTCTGAAAGAGAAAGG + Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108252135 13:48577931-48577953 TTTGTGTCTCAGAAGGAGGAAGG - Intergenic
1108456815 13:50624054-50624076 CTGGAAACTCAGAAAGGAGAGGG - Intronic
1108493832 13:51005489-51005511 ATGGAGCCTGAGAAAGAGGAGGG - Intergenic
1108605344 13:52031812-52031834 TCTGAGACTCAGAAAGATAAAGG - Exonic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108822425 13:54369604-54369626 TTGGAGGCTCAGAAGGGAGAGGG - Intergenic
1108976642 13:56452319-56452341 TTGGAGACTCAGAATAGGGGAGG - Intergenic
1109483629 13:62990278-62990300 TTGGAAACTCAGAAGGGAGAGGG - Intergenic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1109943635 13:69404518-69404540 GTGGGGAGCCAGAAAGAGGATGG - Intergenic
1110358138 13:74592936-74592958 TTGGAGAGTAAGGGAGAGGAGGG - Intergenic
1110658860 13:78034390-78034412 TTGGAGAGTAAGAAATAAGATGG + Intergenic
1110796944 13:79649952-79649974 TTGGAGACTCGGAAGTAGGGAGG - Intergenic
1111164542 13:84441853-84441875 TTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113050290 13:106203835-106203857 TTGGAGACTCAGAGGGGGAAGGG - Intergenic
1113673189 13:112188868-112188890 CTGTAGACTAGGAAAGAGGAAGG + Intergenic
1113983488 13:114295583-114295605 TCAGAGACGCAGGAAGAGGAGGG - Intronic
1114363568 14:22002878-22002900 CTGCAGACTCAGAAAGAAAACGG - Intergenic
1114661987 14:24352609-24352631 TTGGAGACTCAGATGTGGGAAGG + Intergenic
1114952514 14:27773645-27773667 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1115371366 14:32618351-32618373 TTGGCGACTCAGAAGCAGGGAGG - Intronic
1115475201 14:33806682-33806704 TAGGAGACACAGAAAGCAGAAGG - Intergenic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116073437 14:40080018-40080040 TAGGAGAGTGAGAAAGAGGAGGG - Intergenic
1116754774 14:48933362-48933384 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1116941760 14:50797926-50797948 TGGGAGACTGAGGAGGAGGAGGG + Intronic
1117207162 14:53455300-53455322 CTGGAGACTCAGAAAGAGTGAGG + Intergenic
1117517965 14:56521377-56521399 TTGGAGAGTTAGAAGGGGGAGGG - Intronic
1117636895 14:57753734-57753756 GTGGAGAATCAGGAAGAGGTTGG - Intronic
1117637210 14:57755993-57756015 TAGCAGAGTCAGAAAGAGTAAGG - Intronic
1117640501 14:57793399-57793421 TTGGAGGCTCAGAAGGTAGAAGG - Intronic
1117997262 14:61489542-61489564 TAGGAGACTCAGCAAGGGAAGGG + Intronic
1118433557 14:65747739-65747761 TTAGAGACTCAGAAAGAGGAGGG + Intergenic
1118979477 14:70704688-70704710 TAAAAGACTCAGAAAGAGAAAGG + Intergenic
1119325012 14:73754683-73754705 CTGGGGCCTCAGACAGAGGAAGG + Intronic
1119755154 14:77112396-77112418 TTTTAGAGTCAGACAGAGGATGG + Intronic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1124216451 15:27811348-27811370 TTGGAGATTCAGAATGGGAAGGG + Intronic
1126138531 15:45416393-45416415 GAAGAGACTCAGAAAGAGGGAGG - Intronic
1126304046 15:47234501-47234523 TTGGAGACTCAGGAAGGGGAAGG - Intronic
1126413821 15:48397714-48397736 GTGGTGGCTCAGAAAGTGGAAGG - Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126715864 15:51516795-51516817 TTAGAGACTCAGAAGAGGGAGGG - Intronic
1126753413 15:51900357-51900379 TTGGCGACTCAGGATGGGGATGG + Intronic
1126966703 15:54062345-54062367 TAGGAGAATCACACAGAGGATGG - Intronic
1127065700 15:55235672-55235694 TAGGAGACTTTGAAAAAGGAGGG - Intronic
1127449526 15:59103277-59103299 TTAGAGACTCAGAAGAGGGAGGG - Intergenic
1127767425 15:62200508-62200530 TTGGAGACTCCAAAAGTGGGAGG + Intergenic
1128691618 15:69728440-69728462 TTGAAGACTCAGAAGCAGGGAGG - Intergenic
1129229502 15:74188983-74189005 ATCGAGACCCAGAGAGAGGAAGG + Intronic
1129673988 15:77622488-77622510 AGGGAGACTCAGAAAGGTGAGGG + Intronic
1130043073 15:80421240-80421262 TTGGAGACTCAGAAGGGTGGAGG + Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130374418 15:83315522-83315544 TTGGAGACTCAGAAGCGGGGAGG + Intergenic
1130708901 15:86260137-86260159 TTGGAGGCACAGCAAGAGCAAGG + Intronic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1131268807 15:90934412-90934434 CTGGAGAATCAGACAGACGAGGG - Intronic
1131329377 15:91482519-91482541 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1131620077 15:94058909-94058931 TTTGAGACCCAGAGTGAGGAAGG - Intergenic
1131994688 15:98122754-98122776 ATGAAGACTCAGAGAGAAGATGG - Intergenic
1132345649 15:101107199-101107221 TTGGAGACTCAAAACAATGATGG + Intergenic
1132542913 16:519657-519679 TGGGAGACTCAGAGATTGGAGGG + Intronic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133230812 16:4365690-4365712 TGGGAAGCTCAGGAAGAGGAGGG - Intronic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133542090 16:6765962-6765984 TTGGAGACTCAGAAGATGGGAGG + Intronic
1133578486 16:7118412-7118434 TCAGAGACTCAGAAGGAGGGAGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133712036 16:8410780-8410802 TTGGAGACTCAGAAGCAGAGAGG + Intergenic
1133886942 16:9838894-9838916 CTGGAGACTCAGAAAGGGAGAGG + Intronic
1134380914 16:13725097-13725119 TTGGAGACTCAGAAATGGGGAGG + Intergenic
1134586196 16:15413532-15413554 TTGTGGACAAAGAAAGAGGAAGG - Intronic
1134747348 16:16598543-16598565 TTGGGGAGTCAGAAGCAGGAAGG + Intergenic
1134998123 16:18755115-18755137 TTGGGGAGTCAGAAGCAGGAAGG - Intergenic
1135182359 16:20286919-20286941 TTGAAGCCACAGAAAAAGGATGG - Intergenic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135948590 16:26889844-26889866 TTCCAGACTCAGAAAGAGGAGGG - Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136013973 16:27383250-27383272 GTAGAGGCTCAGAGAGAGGAAGG + Intergenic
1136448339 16:30337573-30337595 CCTGAGACCCAGAAAGAGGAAGG - Intergenic
1136507317 16:30713060-30713082 ATGGAGCGACAGAAAGAGGAGGG - Intronic
1136651103 16:31672076-31672098 TTAGAGACTTAGAAGGGGGAGGG - Intergenic
1137830220 16:51537104-51537126 ATGAAGACTCAGAAAGACTAAGG - Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138862997 16:60781861-60781883 TTTGAGGCTCAGAAAGATGACGG - Intergenic
1138938956 16:61766146-61766168 TTGGAAACTCAGAAGGGGGTAGG - Intronic
1139023924 16:62789939-62789961 TGAGAGACTCAGAAGGGGGAGGG - Intergenic
1139138763 16:64235601-64235623 TGGGAGCCTCAGAAAGAAAATGG + Intergenic
1139305913 16:65986243-65986265 TTGGAGACTCAGAAGGGAAAAGG + Intergenic
1139964151 16:70736347-70736369 TCTGAGACTCAGAATGAGAACGG - Intronic
1140339859 16:74146849-74146871 TGGGAGGCTCAGGAGGAGGAGGG - Intergenic
1140659629 16:77175435-77175457 TTGGAGACTCGGAAGAAGGTGGG + Intergenic
1140705238 16:77622657-77622679 TTGGAGACTGAGAAAGGGGAAGG - Intergenic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1141337984 16:83175442-83175464 GTGGAGACTGGGGAAGAGGAAGG + Intronic
1141769094 16:86078080-86078102 TTGGAAGCTCAGGAAGAGGTAGG - Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1141986396 16:87583007-87583029 TTGGAGGCTCAGGAGGAGGTGGG + Intergenic
1142047534 16:87935258-87935280 CCTGAGACCCAGAAAGAGGAAGG + Intronic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143816674 17:9522031-9522053 TTGGAGACCCAAAAAAATGATGG - Intronic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1143989105 17:10941702-10941724 TTTTATGCTCAGAAAGAGGAGGG - Intergenic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144637498 17:16919646-16919668 TTGGAGACTCCCCAAGGGGAAGG - Intergenic
1144951306 17:18995514-18995536 TTGCAGTCTCAGAAGGTGGAAGG + Intronic
1145240859 17:21240511-21240533 TTGGAGAATGAGGAAGGGGACGG + Exonic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146542442 17:33709093-33709115 ATGGAGACCCAGAAAGATGTAGG - Intronic
1146582354 17:34049953-34049975 CTGGAGACTCAGAAATAGTTGGG - Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1146799513 17:35807480-35807502 TTGGAGAGACAGAAATAGGAAGG - Intronic
1147173319 17:38634694-38634716 TTGGAGACTAAGAAGCAGAATGG - Intergenic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147504997 17:41007159-41007181 TTAGAGACTCAAAAAGTGGAGGG + Intergenic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148446235 17:47739287-47739309 ATGGAGACACAGGAAGAGGCTGG - Intronic
1149020235 17:51955195-51955217 TTCGAGATGCAGAAAGATGAAGG - Intronic
1149160007 17:53681177-53681199 TGGGAGTCCCAGAAAGAGAAAGG - Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149857992 17:60101474-60101496 TTTGAGAGTCCGAAAGATGATGG - Intergenic
1150204531 17:63392357-63392379 TTGAAAATCCAGAAAGAGGAGGG - Intronic
1150649163 17:66998725-66998747 TTGGAAACTGAGCAAGAGGCAGG - Intronic
1151019339 17:70595997-70596019 TTAGAGTCTCAGAATGAGGTGGG + Intergenic
1151404117 17:73875847-73875869 TTGGAAACCCAGAGTGAGGAGGG - Intergenic
1152332270 17:79680119-79680141 TTCGAGACTCAGAGGCAGGAGGG - Intergenic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1155092857 18:22528145-22528167 GTGGAGACAGAGGAAGAGGATGG - Intergenic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155530307 18:26759928-26759950 TTGGAGAATCTGGTAGAGGAAGG + Intergenic
1155641321 18:28019129-28019151 TTGGAGACTCAGGGAAAGGGTGG + Intronic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156020120 18:32589943-32589965 AAGGAGTCTCAGAAAGAGGGTGG + Intergenic
1156114981 18:33776632-33776654 TTGTAGCCTCTGAAAAAGGAAGG - Intergenic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1158272696 18:55733763-55733785 TTGGAGGGTCAGAAGCAGGAAGG + Intergenic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158787630 18:60734895-60734917 GTGAAGACACAGAAAGAAGATGG - Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1159029795 18:63219146-63219168 TTGGAGAATCAGAAAAAGCCTGG - Intronic
1159768984 18:72526662-72526684 TTGGAGACTCAGATGCAGGGAGG - Intergenic
1159801301 18:72903244-72903266 TTGGAGAATCAGAAGAAGGGAGG - Intergenic
1160007894 18:75081674-75081696 TTGTACACTCAGAAACAGGTGGG - Intergenic
1160331894 18:78001281-78001303 TTAGAGACTCAGAAGGGGAAGGG - Intergenic
1160923225 19:1530191-1530213 GTGGAGGCTCAGGGAGAGGAGGG - Intronic
1161397332 19:4051793-4051815 TGGGAGGCCCAGAGAGAGGAAGG + Intronic
1161810858 19:6470450-6470472 ATGGAGACTCAGAGAGGGAAAGG - Intronic
1162154563 19:8668475-8668497 TAGGTGACTCAGAAAGATAAAGG - Intergenic
1162756585 19:12864564-12864586 ATGGAGACTCAAAGAAAGGATGG - Intronic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1162964120 19:14148018-14148040 TTGGAGACAGAGAAAGGGGAAGG + Exonic
1163171247 19:15532746-15532768 TTGGAGTCTCAGAACCAGGCAGG - Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163381941 19:16975008-16975030 TTGGAGATTCAGAAATGGGTTGG - Intronic
1163688507 19:18725662-18725684 TGGGAGGCTCAGGAAGAGGGAGG - Intronic
1163888985 19:19994147-19994169 TTGGAGCCTTAGAAACAAGATGG - Intergenic
1164342007 19:24412053-24412075 TTGTAGAATCTGCAAGAGGATGG + Intergenic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164901388 19:31928515-31928537 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1165076942 19:33284800-33284822 TTGGAAAGACAGAAAGATGAAGG - Intergenic
1165300016 19:34962941-34962963 GTGGAGGGTGAGAAAGAGGAGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166519401 19:43470261-43470283 TCTGAGACCCAGAGAGAGGAAGG + Intergenic
1166602117 19:44105674-44105696 ATGGAGACTCAAAATGGGGAGGG - Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1166888747 19:45976765-45976787 TGAGAGACTCAGAAAGGGTAAGG - Intergenic
1167114076 19:47478877-47478899 TTGGAGATTCAGAAGCAGGAAGG + Intronic
1167203138 19:48081421-48081443 TCAGAGATTCAGAAAGAGGAGGG + Intronic
1167359165 19:49020700-49020722 ATGGAGACTCAAAGATAGGAGGG + Intergenic
1167628400 19:50607525-50607547 CAGGGGACTGAGAAAGAGGATGG - Intergenic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167793385 19:51693966-51693988 ATGGAGACTCAGAGAGGGGGAGG + Intergenic
1168454579 19:56496453-56496475 TTGGAGAAACTGAAAGGGGAAGG + Intergenic
1168485696 19:56760169-56760191 TTGGATGCTCAGAGACAGGATGG + Intergenic
925438808 2:3866394-3866416 TTGGGGCCTCAGCAAGGGGAAGG + Intergenic
925572799 2:5330045-5330067 TTATTGACTCAGAAGGAGGAGGG - Intergenic
925633531 2:5919196-5919218 TATGAGACCCAGAAAGAGAAAGG + Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927144662 2:20154947-20154969 TTGGAGTCTCAGAAAGAGGTGGG + Intergenic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927323513 2:21775697-21775719 TTGGAAACTAACAAAGAGAAAGG + Intergenic
927512864 2:23655228-23655250 TGGGAGACGCAGCAACAGGAAGG - Intronic
927969416 2:27295647-27295669 TTTGTGGCTCAGGAAGAGGAAGG + Intronic
928126764 2:28621725-28621747 TTAGAGACTCAAACAGAGCATGG - Intronic
928409367 2:31042656-31042678 GTGGAGAGTAAGGAAGAGGAAGG - Intronic
928479676 2:31669264-31669286 TTTGAGACTCAGAATGGGGAGGG - Intergenic
928761110 2:34584081-34584103 TTGGAGACTGAGAAGTGGGAAGG + Intergenic
929567522 2:42999197-42999219 TTGGAGACCAAGATAGAGGGAGG + Intergenic
930349695 2:50234805-50234827 TCGGAGATTCAGAAAGAAGAAGG + Intronic
930379761 2:50613224-50613246 TTAGTGACTCAGAGAGAGGCTGG - Intronic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930524527 2:52511060-52511082 ATGGAGACTCAGTAACAGGATGG + Intergenic
930528325 2:52559784-52559806 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
930950131 2:57131332-57131354 TTGGAGACTCAAAAAGGAGGAGG - Intergenic
931459215 2:62435656-62435678 GAGTAGACTCAGAAAGAGTATGG - Intergenic
932803101 2:74760137-74760159 TTGGTGACTCAGAAAAGAGAGGG - Intergenic
932836984 2:75047041-75047063 TTGGAGACTGGGTCAGAGGAAGG + Exonic
932875062 2:75442793-75442815 TTGGAGATTCAGAAGTGGGAAGG + Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933173170 2:79146920-79146942 TTGGAGACTCAGGGTGGGGAGGG - Intergenic
933232941 2:79830066-79830088 CTGGAGACTGAGAGAGACGAGGG + Intronic
933294827 2:80477515-80477537 ATGGAGACTCAGAATGGGAAAGG - Intronic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934476541 2:94597282-94597304 TTGGAACCTCAGAAGCAGGAGGG + Intronic
934484794 2:94695637-94695659 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
934894039 2:98097253-98097275 TTGGAGACTCAGAAGTGGGGAGG - Intronic
934968586 2:98744529-98744551 TTGAGGACTCAGACACAGGAAGG + Intergenic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
935706301 2:105860476-105860498 TAGGCGTCTCAGAATGAGGAGGG + Intronic
936029114 2:109057636-109057658 TCGGAGGCTCAGAAAGACCAAGG - Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
936596819 2:113856012-113856034 ATGAAGATTCAGAAAGTGGAAGG + Intergenic
937673619 2:124564999-124565021 TTGGGGATGCAGAAAGAGCATGG + Intronic
938999682 2:136719967-136719989 TTAGCCACTCAGAAAGTGGAAGG + Intergenic
939027417 2:137030758-137030780 CTGGAGACTCAGAAATGGGGAGG + Intronic
939106173 2:137951166-137951188 TTGGAGACTCAGAAGTGGAAGGG - Intergenic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
941702611 2:168620259-168620281 TTGGGGACTCAGGGAAAGGATGG + Intronic
942062387 2:172239749-172239771 TTGAGGAGTCAGAAAAAGGAAGG + Intergenic
942473331 2:176286422-176286444 TTGAAAACACAGAAAAAGGAAGG - Intronic
942981130 2:182083408-182083430 TTGGAGACTCAGAAATGGGCAGG - Intronic
943265258 2:185722669-185722691 TTGGAGACTTAGAAGTAGGGAGG - Intergenic
943322624 2:186464447-186464469 TTAGAGACTCAGAAGTAGGAGGG + Intergenic
943762464 2:191624796-191624818 GTGAAGACACAGAAAGAAGATGG - Intergenic
945327680 2:208501550-208501572 CTAGAGACTCAGAAAGGGGGAGG - Intronic
945373916 2:209056534-209056556 TTGGAGATTCAGAAAAGGGGAGG + Intergenic
946150517 2:217764156-217764178 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
947131508 2:226931477-226931499 TTTGAGACTCAGAAGGGGAAAGG + Intronic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
947569032 2:231216553-231216575 AAGGAGCCTCAGAGAGAGGATGG + Intronic
947746286 2:232508876-232508898 ATGGAGGCTCAGAGAGAAGAGGG - Intergenic
948477007 2:238226811-238226833 TTGGAGGATGAGACAGAGGAGGG - Intronic
948653183 2:239461926-239461948 TTGGAGACACAGAGAGAGAATGG + Intergenic
948669853 2:239561306-239561328 CTGGAGACTCAGAAAGGAGGTGG - Intergenic
948746781 2:240102205-240102227 TTAGAGACTAAGAAAGGGGAGGG + Intergenic
948917542 2:241043065-241043087 TTGGAGTCTGCGAAGGAGGATGG + Intronic
1168932837 20:1637839-1637861 CTGGAGAATCAGAAAAATGAGGG + Intronic
1168936833 20:1672983-1673005 TTAGAGAATCAGAAAAATGAAGG + Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169416576 20:5422345-5422367 TTAGAGACTCAGAAGCTGGAGGG + Intergenic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1169801285 20:9514929-9514951 TTGGCGACTGGGAGAGAGGACGG + Intronic
1170092018 20:12599739-12599761 TTGGAGACTCAGAAAGCTGGAGG + Intergenic
1170412914 20:16109673-16109695 TTGGAAAGAAAGAAAGAGGAGGG - Intergenic
1170455188 20:16526167-16526189 CTGGGGACTCAGGAAGAGAACGG - Exonic
1170809195 20:19660292-19660314 TTGGAGACTTAGAAGGTGGGGGG - Intronic
1170813724 20:19695703-19695725 CTGGAGACTGAAAAACAGGAAGG - Intronic
1170834059 20:19868691-19868713 TTGGGGACCCAGAAAGGGGAAGG + Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1172056091 20:32155278-32155300 CTGGGGACTCAGAAAAGGGAAGG - Intronic
1172603456 20:36199234-36199256 ACCGAGACCCAGAAAGAGGAAGG + Intronic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173532437 20:43780717-43780739 ATGGAGGCTCAGAGAGATGATGG - Intergenic
1173575390 20:44110110-44110132 TTGGAGACTCAGAGCCAGGTAGG - Intergenic
1173903423 20:46607643-46607665 TCTGAGACTCAGGAAGGGGAAGG - Intronic
1174197928 20:48786380-48786402 AAGGAGACTCAGGGAGAGGAGGG + Intronic
1174284894 20:49465514-49465536 ATGGAAACTCAGAGAGAAGAAGG + Intronic
1175040577 20:56046458-56046480 TTAGAGACTCAGAAGAAAGAGGG + Intergenic
1175287435 20:57846321-57846343 TTAGAGAATGAGAAAGAGTATGG - Intergenic
1177267710 21:18805880-18805902 TTCGAGTCTCAGAATGGGGAGGG + Intergenic
1177832357 21:26153130-26153152 TTAGAGACTCACGAGGAGGAGGG + Intronic
1178741550 21:35206621-35206643 TCAGAGACACAGAGAGAGGAGGG - Intronic
1178755710 21:35347479-35347501 TTGGGGACTCAGAAAGGTGAGGG - Intronic
1178901380 21:36601611-36601633 TTAGAGACCCAGGAAGGGGAGGG + Intergenic
1178925849 21:36774316-36774338 GTGGAGACTCAGACAGGGAACGG + Intronic
1178936064 21:36862814-36862836 CTGGAGACTCACCAAAAGGAAGG + Intronic
1179056357 21:37938754-37938776 TTGGGAACTCAGGAAGGGGAAGG + Intergenic
1179068082 21:38045111-38045133 TAGTAGACACAGAAAAAGGAGGG - Intronic
1179182413 21:39057169-39057191 CTGAAGACTCAGTAAGATGAAGG + Intergenic
1179313248 21:40215640-40215662 TTGGAGACTCAGAAGTGGGGAGG + Intronic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1181839737 22:25646424-25646446 TTGGAGTTTCAGAAAGAGAAGGG + Intronic
1182415724 22:30220338-30220360 TGGGAGGCTAAGGAAGAGGATGG - Intergenic
1183896958 22:40977159-40977181 CTGGAGCCTCAGAACCAGGAGGG + Intergenic
949696927 3:6708372-6708394 ATGGAGACTCAGAAATTGAAAGG - Intergenic
949769275 3:7561029-7561051 TTGGAGACTAAGACACAGGCAGG - Intronic
949944179 3:9177221-9177243 ATGGAGACTCCGTAACAGGAGGG - Intronic
950128621 3:10526799-10526821 ATAGAGACTCAGAGAGGGGAAGG - Intronic
950482352 3:13252230-13252252 TTGTAGAGACAGAAAGTGGAAGG - Intergenic
951438519 3:22693951-22693973 TTGGAGACTCGGAAAGGGGATGG - Intergenic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952493147 3:33891235-33891257 TTGGAGACTCAGAAGAGAGAGGG - Intergenic
952618086 3:35299896-35299918 TTAGAAACTCAGAAACGGGAGGG - Intergenic
952641651 3:35603800-35603822 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
952643374 3:35625390-35625412 TTGGAGACTCAGAAGTGGGATGG - Intergenic
952685194 3:36139543-36139565 TATGAGATTCAGCAAGAGGAAGG + Intergenic
952749202 3:36811533-36811555 TTAGGGACTCAGAAGGTGGAGGG + Intergenic
953028974 3:39163967-39163989 TTGAAGACTCAGAAGTAGGGGGG - Intergenic
953081239 3:39620530-39620552 TTAGAGACCCAGAAATGGGAGGG + Intergenic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953824510 3:46239184-46239206 TTGGAGAAAAACAAAGAGGACGG - Intronic
953869811 3:46616484-46616506 TTGGAGACTCAGAAGGAAAGAGG - Intronic
954517205 3:51189418-51189440 TTAGAGACTCAGAAAGGGGAGGG - Intronic
954580867 3:51702348-51702370 CTGGGGCCTCAGCAAGAGGAGGG + Intronic
955032548 3:55234811-55234833 TTGGAGACTCAGGAGGGGGATGG - Intergenic
955123390 3:56084690-56084712 TTGGAGACTTAGAAGCAGGAAGG + Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956078368 3:65530867-65530889 ATGGAGAGAGAGAAAGAGGAGGG + Intronic
956314503 3:67919515-67919537 TTGGAGACTCTGAAAGTGGGAGG - Intergenic
956390480 3:68767628-68767650 TTTGGGACACAGAAAGATGAGGG + Intronic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
956856093 3:73276273-73276295 TTGGAGACTCAGAAGTAGGCTGG - Intergenic
956914908 3:73860750-73860772 TGGAGGACTCAGAAAGAAGAAGG + Intergenic
958524684 3:95240810-95240832 ATGGAGAGCTAGAAAGAGGATGG + Intergenic
958811821 3:98868610-98868632 TCGGAGACTCAGAAAGGGGGAGG - Intronic
958859930 3:99434354-99434376 TTGGTGACTCAGAAGGAGAAGGG - Intergenic
958986471 3:100784868-100784890 TTAGAGACCCAGAAGGGGGAGGG + Intronic
959352290 3:105281090-105281112 TTGGAGGCTCAGAAGGATGTGGG + Intergenic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960414953 3:117373246-117373268 TTGGATACTCAGAAGGTAGAGGG - Intergenic
960509716 3:118534493-118534515 ATGGAGCCTCAGAGAGATGATGG + Intergenic
960551590 3:118981924-118981946 TTACAGACCCAGAAAGAAGAGGG - Intronic
960752283 3:120968711-120968733 TTGGATACTCAGAACGGGGGAGG - Intronic
961955577 3:130799608-130799630 TCAGAGACTCAGAAGGAGGATGG + Intergenic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962011317 3:131393777-131393799 TTGGATTCTCAGATAGGGGATGG - Intergenic
962464375 3:135643005-135643027 TTGGAGTCTCACAATGAGGCGGG + Intergenic
962704961 3:138034139-138034161 ATGGAGACTCAGAAAGTTTAAGG - Intergenic
962851012 3:139308406-139308428 TGGGGGACTCACACAGAGGAAGG - Intronic
963168667 3:142229952-142229974 TTGGAGACCCAGAAATGGGAGGG + Intergenic
963180736 3:142353021-142353043 TTAGAGACTCAGACAAAGAAAGG - Intronic
964635497 3:158853822-158853844 TTGGAAACTCAGAAGGAAGGTGG - Intergenic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965863004 3:173169780-173169802 TTGGAGACCAAGAAAGAGCATGG + Intergenic
967188817 3:186967764-186967786 ATGGAGGCCCAGAAAGGGGAAGG + Intronic
967790523 3:193543941-193543963 TCTGAGACTCAGAAAGAGGCTGG + Intronic
967940934 3:194766063-194766085 TTGGAGACTCAGATGCAGGGAGG + Intergenic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968359351 3:198136626-198136648 TTGGTGGCTCAGATAGAGGTGGG + Intergenic
968857548 4:3138394-3138416 TTGGAGACTCACAAGGCGGAAGG - Intronic
969246436 4:5936263-5936285 TTAGAAAGACAGAAAGAGGATGG + Intronic
969897174 4:10316274-10316296 TTGGAGACTCAGAAGGGTCATGG - Intergenic
970165722 4:13235849-13235871 TTGGAGACTCAGAAAAGGGGAGG + Intergenic
970200161 4:13596297-13596319 TTCTAGACTCAGAGACAGGAGGG - Intronic
970290186 4:14563493-14563515 TTGCTGATTCAGAAAAAGGAGGG + Intergenic
970497914 4:16645807-16645829 ATTGAGACTTAGAAAGATGAAGG - Intronic
970564733 4:17320686-17320708 TTGGAGAACCAAAAAGAAGAAGG - Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972446038 4:39144713-39144735 CTGGAGACTCAGAAATGGGGAGG - Intergenic
973192408 4:47400727-47400749 TTGGAGACTCAGAAGTGGGGAGG - Intronic
973695061 4:53482688-53482710 TTGGAGACTCAGAAAAGGGGAGG + Intronic
973950784 4:56011306-56011328 TTGGAGAATAAGATAGAGTAGGG - Intronic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974490058 4:62553146-62553168 TTAGAGACTCAGAAAGGAGAGGG - Intergenic
974962980 4:68726646-68726668 TTAGAGACTCAGAAAGGAGAGGG - Intergenic
975290482 4:72672115-72672137 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
975380823 4:73698870-73698892 TTGGAGACTCAGAGCAGGGAGGG - Intergenic
975437445 4:74369307-74369329 TTAGAGACTCAGAAGGGGAAGGG - Intronic
975953222 4:79800730-79800752 GTGAAGACACAGAAAGAAGATGG + Intergenic
976171927 4:82313263-82313285 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
976703254 4:87993879-87993901 TAGTACACTCAGAAAGAGCATGG - Intergenic
977198948 4:94092490-94092512 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
977509533 4:97945214-97945236 TTGGAGACTTAGAAAGGGGAGGG - Intronic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
977707636 4:100088998-100089020 CTGGAGACTCAGAACGGGAAGGG - Intergenic
977910285 4:102526325-102526347 ATGGAGATTCAGAAAGGTGAGGG + Intronic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978901273 4:113952435-113952457 TTGAAGACTCATAAAAAGCAAGG - Intronic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG + Intergenic
980747638 4:137040303-137040325 TTGGAAACTCAGAATGGGGGAGG - Intergenic
980848136 4:138348774-138348796 TTAGAGACACAGAAGGAGGAAGG + Intergenic
980963800 4:139501419-139501441 TCAGAGACTCAGAAGGGGGAGGG + Intronic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
981381410 4:144076245-144076267 TTGGAGACTCAGAAGCGGGTGGG - Intergenic
981529024 4:145734337-145734359 GAGGACACTCAGAAAGTGGAGGG + Intronic
981730553 4:147892670-147892692 TTGGAGACTCAGAGGAAGGGGGG + Intronic
981738491 4:147977815-147977837 CTGGAGACTCCAAAAGGGGAGGG - Intronic
981783215 4:148448364-148448386 AGGGAGAGTCAGAAAGAGAAAGG + Intergenic
981954602 4:150454737-150454759 TTGGAGACTTAGAAGGGAGAAGG - Intronic
982188387 4:152826458-152826480 TTGGAGACTCAGAAGAGGGGAGG + Intronic
982267369 4:153550853-153550875 TTGGAGACTCAAGATGGGGAAGG + Intronic
982334838 4:154222951-154222973 TTGGAATCTCAAAAAGAGAATGG - Intergenic
982422447 4:155213116-155213138 TTGGAGACTCATAAAGGAGAGGG + Intronic
982431777 4:155330889-155330911 TTGGAGACTCAGAAAGGTGGAGG + Intergenic
982765029 4:159336328-159336350 TTGGAGACTCAGAAGGGGAAGGG - Intronic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983010619 4:162540891-162540913 TTGGAGTCTCAGGAAGAGATAGG + Intergenic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
983898523 4:173107108-173107130 TAGGAGACTCAGGAAGAAGAAGG + Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984457774 4:179992727-179992749 TTGGGGACTCAGGACAAGGACGG + Intergenic
984475424 4:180228880-180228902 TTGGAAACACAGTAAGATGAAGG - Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
985042839 4:185909366-185909388 TTGGAGACTCAGAAGGGCTAGGG + Intronic
985671573 5:1209494-1209516 TTGGAGACTCAGGGAGAGGCTGG - Intronic
985903608 5:2815691-2815713 TTGCAGACTCAAGAAAAGGAAGG - Intergenic
986329091 5:6704400-6704422 TTAGAGACACAGACAGAGGCTGG - Intergenic
986408586 5:7452252-7452274 TTGGAAACTCAGAAATGGGGAGG - Intronic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986539946 5:8834415-8834437 CTGGAGACTCAGAACAGGGAAGG + Intergenic
986616117 5:9619027-9619049 TTGGAGGCTTGGGAAGAGGATGG - Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987315704 5:16721212-16721234 TTTGTGAATCAGCAAGAGGAGGG - Intronic
987618744 5:20310955-20310977 TTGAAGACTCATAAAGTGGCTGG - Intronic
987625555 5:20395428-20395450 CTGGAGACTCAGAAATAGAGAGG + Intronic
988062278 5:26186500-26186522 TTGGAGGCTGAGATAGAGGAAGG - Intergenic
988113599 5:26854874-26854896 TTGGAAACTCAGAAGTAGGGAGG + Intergenic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
988889025 5:35594338-35594360 TTAGAGACTCAGAATGGGGAGGG - Intergenic
988979029 5:36545905-36545927 TTGGAGACTCAGAAGTAAGGAGG + Intergenic
989191939 5:38678869-38678891 CTGGTCACTCAGAAAGAGGGAGG - Intergenic
989407748 5:41080303-41080325 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
989433005 5:41376970-41376992 TTGGAGTCTCACAAATAGCAGGG + Intronic
989607539 5:43258928-43258950 TTGGAGACTTAGAAGGGGTAGGG - Intronic
989685121 5:44076532-44076554 TTGGAGGATCAGAAAAAGAATGG - Intergenic
989723583 5:44559568-44559590 TTGGGGACTCAGGGAGAGGGTGG + Intergenic
990605720 5:57407925-57407947 TTGAAGACACAGAGAGAAGATGG + Intergenic
990709972 5:58569709-58569731 TTGGAGGCGCAGGAAGATGAAGG - Intergenic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992466699 5:77013162-77013184 TTGGAGACGCACAAAAAGGCAGG - Intergenic
992503938 5:77367107-77367129 TTGTAAACTTAGAAAGAGGAGGG + Intronic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG + Intronic
993313885 5:86374779-86374801 TTGAAGTCTCTCAAAGAGGATGG - Intergenic
993540051 5:89138136-89138158 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
993605770 5:89989264-89989286 TTGGAACCTGGGAAAGAGGAGGG - Intergenic
994313544 5:98305497-98305519 TTGAAGACTCAGAAGTGGGAAGG + Intergenic
994388675 5:99163524-99163546 TTGGAGACTCAGAAATGGGAAGG + Intergenic
994415607 5:99466633-99466655 TTGAAAACTCAGAAAGGAGAAGG + Intergenic
994958828 5:106571460-106571482 TGGGAGACTCTGAAAGGGAAGGG + Intergenic
996077568 5:119214930-119214952 TTGGCGACAGAGAAAGATGATGG - Intronic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996561361 5:124833079-124833101 TTGAAAACACAGAAAAAGGAAGG - Intergenic
996620413 5:125495036-125495058 TTAGAGACTCAGAAGGGGAAGGG + Intergenic
997014404 5:129915008-129915030 TTGGAGACTAAGACAAAGAAGGG - Intronic
997069675 5:130606655-130606677 TTGGGTACTTAGAAAGAGGAAGG - Intergenic
997109563 5:131059917-131059939 TTGAGGACACAGAAAAAGGATGG - Intergenic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999884434 5:155905414-155905436 AAGGAGGCTTAGAAAGAGGATGG + Intronic
999981211 5:156959622-156959644 TTTGAGACTCAGATTGGGGAAGG - Intronic
1000337242 5:160250945-160250967 ATGGAGGCTCAGAGAGAGGTTGG + Intergenic
1000641073 5:163702265-163702287 TTAGAGACTCAGAAGGGTGAAGG - Intergenic
1000821004 5:165983167-165983189 TTGGAGACTCTGAATGGGGGAGG + Intergenic
1001034339 5:168286751-168286773 TGAGAGAGTCAGAAATAGGATGG + Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001425399 5:171619141-171619163 TTGGAGACACAGAAAAGTGATGG + Intergenic
1001427018 5:171629392-171629414 ATGGAGGCTCAGAGAGAGGGAGG + Intergenic
1001760882 5:174207150-174207172 TTGGAAACTCAAAAGGGGGAGGG + Intronic
1001839137 5:174858675-174858697 TGGGAGTCCCAGAAAGAGAAAGG - Intergenic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002419087 5:179136199-179136221 TAGGAGACACAGAGACAGGAAGG - Intronic
1002787749 6:417332-417354 TTGGAGACCCAAACAGAGGGTGG - Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1002969140 6:1996162-1996184 TAGAAGAATGAGAAAGAGGAAGG - Intronic
1002996931 6:2295278-2295300 TTGGAGACTGACAAGGGGGAGGG + Intergenic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003762762 6:9198908-9198930 CTGGTGACTCAGCAAGAAGAGGG - Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1004985277 6:21074974-21074996 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1005161163 6:22865724-22865746 TTGAGGACACAGCAAGAGGATGG - Intergenic
1005285184 6:24318558-24318580 TTAGAGACTCAGAAGGATGCTGG - Intronic
1005422816 6:25670484-25670506 TTGGAGAGTCAGATAGATGAAGG + Intronic
1005454224 6:26003653-26003675 CTGGAAACTCAGAGAGATGATGG + Intergenic
1006241288 6:32681328-32681350 TTGGAGACTCAGAAGAGGGGAGG - Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006324700 6:33344909-33344931 GTGGAGAGTCAGACACAGGAAGG + Intergenic
1006361027 6:33587158-33587180 ACTGAGGCTCAGAAAGAGGAAGG - Intergenic
1007015083 6:38457523-38457545 TTGGGGACTAAAAAATAGGATGG + Intronic
1007040357 6:38715747-38715769 TCGGAGACTCAGAAGGGGAAGGG + Intronic
1007412785 6:41674606-41674628 CAGGAGACTCTGAAAGTGGAAGG - Intergenic
1007493223 6:42240576-42240598 GTTGAGACCCAGAGAGAGGAAGG - Intronic
1009271374 6:61619262-61619284 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1009709998 6:67305925-67305947 CTGGAGACTCAGAAAGGAGGAGG - Intergenic
1010452037 6:76014331-76014353 TTTGAAACTCAGAGGGAGGAAGG + Intronic
1010568991 6:77455002-77455024 TTGGAGATTTAAAATGAGGAGGG + Intergenic
1010663944 6:78604293-78604315 TTAGGGAATCAGATAGAGGAAGG - Intergenic
1010815465 6:80353062-80353084 ATGGAGACTCAGAGAGGAGAGGG - Intergenic
1010977008 6:82326572-82326594 TTGGAGACTCAGAAGAAAGGAGG - Intergenic
1011505860 6:88043211-88043233 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1011553799 6:88554007-88554029 TTGGAGTCTCAGATGCAGGACGG - Intergenic
1012691550 6:102319321-102319343 TTGGAGGCTCAGAAGAAGAAAGG + Intergenic
1012729698 6:102866682-102866704 TTGGAGACTCAAAAGGGGAAAGG + Intergenic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1013469021 6:110444617-110444639 TTGGACAGTCACAAAGAGGCCGG + Intronic
1013496156 6:110699563-110699585 TTGGAGATTCAGAAGAAGGGAGG + Intronic
1013498532 6:110723058-110723080 GTGCACACTCAGACAGAGGAGGG - Intronic
1013508649 6:110824407-110824429 CTGGAGACTCAGAAAAGGGAGGG + Intronic
1013954208 6:115821574-115821596 TTAGAGACTCAGAAGAAGAAGGG + Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014393648 6:120896133-120896155 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016092300 6:139994498-139994520 TTTGAGAGGCAGAAAGAGAATGG + Intergenic
1016099771 6:140084878-140084900 GTGAAGACACAGAAAGAAGATGG + Intergenic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016172050 6:141030068-141030090 TTGGAGGCTGAGAAGGAGAATGG - Intergenic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1016619883 6:146096362-146096384 ATGGAGCCTAAGTAAGAGGAAGG + Intronic
1017053338 6:150414784-150414806 TGGTTGCCTCAGAAAGAGGAGGG - Intergenic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017375630 6:153764496-153764518 TTAGAGGCTCAGAAGGAGCAGGG + Intergenic
1017498343 6:155001165-155001187 TTGGTGACTGAGAAAATGGAGGG + Intronic
1017580548 6:155859866-155859888 TTGCAGACTCATTAAGTGGAAGG + Intergenic
1017589585 6:155964361-155964383 TTGGGGATTCAGAAATATGAGGG - Intergenic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1018945398 6:168344394-168344416 TTGGAGACGGAGGAAGAAGATGG - Intergenic
1019098861 6:169610880-169610902 TTGGAGACTCACAAGGGGGCAGG + Intronic
1019260644 7:80050-80072 TTGGTGGCTCAGATAGAGGTGGG - Intergenic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1020560981 7:9728341-9728363 TTGGAGATTCAGAAATGGGTTGG + Intergenic
1020929201 7:14372056-14372078 TTGGAGGCGCTGAAAGAGAAAGG - Intronic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1021085121 7:16413476-16413498 TTAGAGATTCAGAATGAGAAAGG - Intronic
1021466500 7:20949987-20950009 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
1021873132 7:25023194-25023216 TTGGAGACTCTGAAGGGGGAGGG - Intergenic
1022751417 7:33230577-33230599 TTGCAGACTCAGAAGCAGGCAGG - Intronic
1023868849 7:44252073-44252095 TCCGAGACTCAGACTGAGGAGGG + Intronic
1024062283 7:45708178-45708200 TAGGAGACTAAGAGAGAGGCAGG - Intronic
1024094568 7:45973720-45973742 TGGGAGACTCAGAAAAGTGAGGG + Intergenic
1025164067 7:56695403-56695425 TTTGAGATTCAGAAAGAAGGTGG + Intergenic
1025706219 7:63866675-63866697 TTTGAGATTCAGAAAGAAGGTGG - Intergenic
1026068160 7:67094002-67094024 CTAGAGACTCCAAAAGAGGATGG - Intronic
1026219359 7:68379464-68379486 TTTGAAACTCAGGAAGACGAAGG - Intergenic
1026506927 7:70992804-70992826 TTGGAGACTCACAAATGGGCAGG - Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026708760 7:72718306-72718328 CTAGAGACTCCAAAAGAGGATGG + Intronic
1027303817 7:76870697-76870719 TTAAAGACTCAGAAAGGGGTGGG + Intergenic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027528723 7:79303145-79303167 TTGGAGACTCAGAGGGTGGAAGG + Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1027918956 7:84365478-84365500 TTGGAGACAAAGAGAGATGAGGG - Intronic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028199712 7:87947039-87947061 CTGGGGACTAAGAGAGAGGAAGG + Intronic
1028308381 7:89295985-89296007 TTAGAGACTCGGAAGGAGTAGGG + Intronic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028524961 7:91773787-91773809 ATGGATACTAAGAAAAAGGAAGG - Intronic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1028967498 7:96818269-96818291 TTGGAGACTCAGAAGAGGGGTGG - Intergenic
1029528300 7:101108871-101108893 TCGGTGGCTCAGAAAGAGAAGGG + Intergenic
1029806854 7:103007137-103007159 CTGGAGTCCCAAAAAGAGGAAGG + Intronic
1029928469 7:104344418-104344440 TTGGAGATTCAGAAGGGGAAGGG - Intronic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1030853477 7:114520444-114520466 TTGCAAACTCAGACAGAGTAGGG + Intronic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1031489181 7:122366759-122366781 CTGGATTCACAGAAAGAGGATGG - Intronic
1031656608 7:124363917-124363939 TTAGAGACTCATAAGGGGGAGGG - Intergenic
1031674464 7:124591518-124591540 TTAGAGACTCATAAGAAGGAAGG + Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031827802 7:126588248-126588270 TTGGATACTCAGTAAGAGTTTGG + Intronic
1031852037 7:126877165-126877187 TTGCAGAGAGAGAAAGAGGAAGG - Intronic
1033023502 7:137750767-137750789 TTGGGGACTCAGGAAGATAAAGG + Intronic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034745885 7:153523760-153523782 GTGAAGACTCAGAGAGAAGACGG - Intergenic
1034882543 7:154773604-154773626 TGAGAGACTCAAAAAGAGGAGGG + Intronic
1035081083 7:156216546-156216568 TTGGAGACTCAGAGACAGACAGG - Intergenic
1035130414 7:156647352-156647374 TTGGAGACTCAGGAGGCGGAGGG - Intronic
1035232727 7:157476125-157476147 CTGGAGAATGAGAAACAGGATGG + Intergenic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035522910 8:289833-289855 ATGGAGACTCTGAAAGAGGGAGG - Intergenic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1035889493 8:3328061-3328083 TGTGAGTCTCAGAAAGCGGATGG - Intronic
1035916938 8:3635118-3635140 TGGGTGACTCAGTAAGTGGACGG + Intronic
1035977276 8:4326276-4326298 TGGGAGACTCAGACATAGCAAGG + Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036167779 8:6453138-6453160 TGGGAGAGTCAGGAAGAGGAGGG + Intronic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036612505 8:10362558-10362580 TAGGAAACTCAGAAAGGGGATGG - Intronic
1036658172 8:10691015-10691037 CTGGTGACTCAGAAAGTGGAGGG - Intronic
1036783212 8:11664785-11664807 TTAGAGACTCAGAAGAAAGAGGG - Intergenic
1036986961 8:13543828-13543850 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1037224410 8:16567693-16567715 TGGGAAACACAGAAAAAGGAAGG + Intergenic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038399622 8:27273117-27273139 ATGGTGTCTCAGAAAGAGGAGGG + Intergenic
1039201661 8:35101341-35101363 TTAGAGCCTCAGAAGGAGGACGG - Intergenic
1039208294 8:35182250-35182272 TTGCAGACTCAGAATGGGGGAGG + Intergenic
1039846617 8:41330135-41330157 TTGGAAACTCTGAAAGAGCAAGG + Intergenic
1039859912 8:41448207-41448229 TTGGAGACCCAGTAAGATCAAGG - Intergenic
1039945647 8:42126766-42126788 TTGGAGACAGAGAAGGAGGGAGG - Intergenic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040405186 8:47094743-47094765 TTGGAGACTCAGAAGAAGAAAGG + Intergenic
1040613183 8:49007143-49007165 TTGGGAACTCAGTAAGAGAAGGG + Intergenic
1040719859 8:50306051-50306073 TTAGAGACTCAGAAGGGGGAGGG - Intronic
1040856026 8:51948768-51948790 TTGAAGACACAGAGAGAAGAGGG + Intergenic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1041310321 8:56510115-56510137 TTGGAGCCTAAGGAAGGGGAAGG - Intergenic
1041319254 8:56596363-56596385 TAGGAGACTCAGAAGGTGGGAGG - Intergenic
1041744988 8:61198722-61198744 TTGGAGACTTAGAAGAAGGGAGG - Intronic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1041937351 8:63348477-63348499 TTGGAGACTCAGAAGAGGCAAGG - Intergenic
1042157121 8:65856420-65856442 GTGGAGACTCACAAAATGGATGG + Intergenic
1042179067 8:66066709-66066731 TCGGAGACTCAGAAGGGGGAGGG + Intronic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1043355621 8:79408858-79408880 TTGGAGACTCAGAAGGGGAGAGG - Intergenic
1043360275 8:79464073-79464095 TTTGAGAACAAGAAAGAGGATGG - Intergenic
1043367596 8:79553275-79553297 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1043736315 8:83749771-83749793 TTGGAGACTCAGAAGGGTAAAGG - Intergenic
1043765813 8:84130854-84130876 CTGTAGACTCAAAAATAGGATGG + Intergenic
1043773115 8:84229681-84229703 TTTGAGATTAAGAAAGAGGATGG + Intronic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045976083 8:108131774-108131796 TTCAAGTCTCAGATAGAGGAGGG - Intergenic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046238964 8:111465187-111465209 TTAGAGACTCAGAATGTGGAGGG + Intergenic
1046270882 8:111896734-111896756 TGGGAGCCACAGAGAGAGGAAGG - Intergenic
1046784609 8:118252655-118252677 TGGGAGAAAGAGAAAGAGGAAGG - Intronic
1046870654 8:119202530-119202552 TTAGAGTCTCAGAAGGAGAAGGG - Intronic
1046927890 8:119812478-119812500 TTGGAGACTCAGAAGCGGGGAGG - Intronic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1047022640 8:120792333-120792355 TTGGAGACTCAGAAAAGGGGAGG + Intronic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047197772 8:122736938-122736960 TTGGAGAGGCAGAGAGAGTAAGG + Intergenic
1047504099 8:125465224-125465246 TTGGAGACACAGAGAGGTGATGG - Intergenic
1047633817 8:126737490-126737512 TTAGAGACTCAGAAGGAGAAGGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1050195411 9:3078037-3078059 TTGGATACTCAAAACGGGGAAGG - Intergenic
1050475621 9:6037824-6037846 TTGGAGACTCAGAAGAATGTAGG - Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1050847275 9:10237652-10237674 TTGCAGACCTAGGAAGAGGAGGG - Intronic
1051724652 9:20076548-20076570 TTCGGGATTCAGAAAGAGTATGG + Intergenic
1052489112 9:29140567-29140589 TGGAAGTCTCAGAAAGAGAAGGG + Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052955442 9:34250201-34250223 TTGGAGAGGCAGAGAAAGGAGGG - Intronic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053525064 9:38820818-38820840 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1053672999 9:40388733-40388755 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1053922809 9:43015102-43015124 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054197295 9:62045240-62045262 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054384108 9:64528799-64528821 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054511626 9:65987550-65987572 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054641114 9:67543442-67543464 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1054866087 9:70003215-70003237 TTGGATTCTCAGAAAGATGGTGG - Intergenic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1056024712 9:82481754-82481776 TTGGAGTTTCAGAAAGTAGATGG - Intergenic
1056244028 9:84676508-84676530 TCGGAACCTCAGAAAGAGAAAGG + Intronic
1056281703 9:85047846-85047868 TTGGATACTCAGAAAGGGGGAGG - Intergenic
1057388323 9:94623387-94623409 AGGGAGGCTCAGAAAGAGCAGGG - Intronic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058261190 9:102834657-102834679 CTTGAGAGTCAGAAACAGGAGGG - Intergenic
1058276494 9:103048039-103048061 TTAGAGAATCAGAAGGGGGAGGG + Intergenic
1058348043 9:103988003-103988025 TTGGAGACTCAGAAGTAGGTAGG + Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1059218410 9:112589238-112589260 TGGGAGAATCAGAAAAATGAGGG - Intronic
1059258777 9:112955933-112955955 CTGGAGTCTCAGAGAGAGGCTGG - Intergenic
1059580731 9:115545800-115545822 TTGGAGACTCAGTCAGAAGGGGG + Intergenic
1059580914 9:115547326-115547348 TTGGAGACTCAGTCAGAAGGGGG + Intergenic
1059636923 9:116180130-116180152 TTGGAGTCACAGAATGTGGATGG + Intronic
1059638106 9:116190429-116190451 TTCAAGATTCAGAAAGATGAAGG + Intronic
1059814958 9:117901804-117901826 TGGCAGATTCAGAAAAAGGAAGG + Intergenic
1059989298 9:119849747-119849769 TTGGTAACTCAGAAAAAGCAAGG + Intergenic
1060045429 9:120336711-120336733 GTGGGGAGTCAGAAAGATGAGGG + Intergenic
1060204602 9:121675112-121675134 TTGGCGACTCAGCAGGAAGATGG - Intronic
1060269755 9:122132097-122132119 ACGGAGGCTCAGAGAGAGGAAGG - Intergenic
1060333448 9:122698167-122698189 TTGGAGACTCCGAAGTGGGAAGG + Intergenic
1061074805 9:128334607-128334629 ATGGGGACTCAGAGAGGGGAAGG - Intergenic
1061423518 9:130485012-130485034 CTGGGGGCTCAGGAAGAGGAGGG + Intronic
1061490601 9:130941905-130941927 TTGGTGAGCCAGAAAGAGGAAGG - Intergenic
1061707189 9:132462169-132462191 TTGGAGTCGCAGAAAGGGAATGG + Intronic
1062744039 9:138200340-138200362 TTGGTGGCTCAGATAGAGGTGGG + Intergenic
1203417718 Un_KI270364v1:1653-1675 TTGTAGAATCTGCAAGAGGATGG - Intergenic
1185859566 X:3564982-3565004 TTGGAGACTCCGAAGTGGGAGGG + Intergenic
1185926441 X:4152321-4152343 TTGGACACTCAGAAGGGGGAGGG - Intergenic
1185943489 X:4347809-4347831 TTGGAGACTGGGAAAGGGGATGG + Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186046491 X:5542371-5542393 TTGGAGACTCAGAAAAAGCCTGG - Intergenic
1186714462 X:12235753-12235775 TTAGAGTCTCAGAAAGAACATGG + Intronic
1186792424 X:13011940-13011962 TCTGAGGCTCAGAAAGATGAAGG - Intergenic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187435537 X:19265404-19265426 TCAGAGACTCAGAAGGTGGAGGG - Intergenic
1187586657 X:20669993-20670015 TTGGATACTCAGAAGGGGGAAGG - Intergenic
1187589325 X:20699194-20699216 TTGGGGACTCAGGGAAAGGATGG + Intergenic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188101032 X:26088163-26088185 TTAGAGATTCAGAAAGGGGAGGG + Intergenic
1188154577 X:26725021-26725043 TTGGAGACTCAGACATGGGGAGG - Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188188771 X:27148250-27148272 TTGGAGACTCAAAAAGTGGGAGG + Intergenic
1188206828 X:27370206-27370228 TTGGAGACTCAGAAACAGAAGGG + Intergenic
1188389455 X:29601749-29601771 TTCCAGAATAAGAAAGAGGATGG + Intronic
1188780209 X:34273961-34273983 TTGGACACTCAGAAAGGTGAGGG - Intergenic
1188964293 X:36531897-36531919 TTGGAGACTCAGAAAGCGTTGGG - Intergenic
1189167478 X:38874955-38874977 TTGAAGACTCAGAATGGGGGAGG - Intergenic
1189237580 X:39499558-39499580 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1189268921 X:39736686-39736708 TTGGAGGCTCAGAGAGTGGGTGG - Intergenic
1190056340 X:47183215-47183237 ATGGAGACTCAAAAGGTGGAGGG + Intronic
1190435446 X:50420011-50420033 ACTGAGACTCAGAAAGAGGTAGG - Intronic
1190774776 X:53543970-53543992 TGGGAGAAAGAGAAAGAGGAAGG + Intronic
1191673177 X:63768135-63768157 TTGGAGACTCAGAAGGGGAAGGG - Intronic
1191834546 X:65449839-65449861 TTGGAGACTCAGAAGCATGAGGG + Intronic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1192097084 X:68223534-68223556 TTGGAGACTCAGAAAAAGGGTGG + Intronic
1192284389 X:69719505-69719527 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1192805720 X:74506691-74506713 GGAGAGACTCAGAAAGATGAGGG + Intronic
1192884445 X:75321994-75322016 TTGGAGACTGAGAAGGGGTAGGG - Intergenic
1193187515 X:78530448-78530470 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1193460316 X:81783798-81783820 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1194088515 X:89558244-89558266 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1194089909 X:89572931-89572953 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1194145648 X:90258690-90258712 TTGGAGATTCAGGAGGGGGAAGG + Intergenic
1194182962 X:90736190-90736212 TTAGAGATTTAGAAAAAGGATGG - Intergenic
1194228439 X:91291606-91291628 TTGGAGACTCAGAAGTGGGTAGG - Intergenic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1194465139 X:94225357-94225379 TTGGAGACTCAGAAACGGTGAGG + Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1195002055 X:100651340-100651362 TTTGAGAACCAGAAAGGGGAGGG + Intronic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1195966715 X:110435596-110435618 TTGGAGACTCAGAAAGAAAGTGG - Intronic
1195969856 X:110461343-110461365 TTGGAGACTCAGAGAAATGTTGG + Intergenic
1196134126 X:112188650-112188672 TTGGAGTCACTGAAAGTGGAAGG - Intergenic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1196796847 X:119508749-119508771 CTAGAGACTCAGAAAGGGGAGGG - Intergenic
1197033404 X:121846560-121846582 TTGGACACTGAGACACAGGAAGG + Intergenic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1197371661 X:125634289-125634311 TTGTAGACTTAGAAGCAGGAAGG + Intergenic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1197987602 X:132283612-132283634 TTGGCGTCTCAGAAGGGGGAAGG - Intergenic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1198134421 X:133733273-133733295 TTAGGGACTCAGAAGGGGGAGGG + Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198518202 X:137428799-137428821 TTCGGGACCCAGAACGAGGAAGG + Intergenic
1198676451 X:139136354-139136376 TTAGAGACTCAGAACGGGGAGGG - Intronic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1199010842 X:142756738-142756760 TTGGAGACACAGAGAGGGGAGGG - Intergenic
1199078096 X:143546956-143546978 TTAGAGACTCAGAAGGGGGAAGG + Intergenic
1199110821 X:143931843-143931865 TTGGAGATTCAGAAGGGGAAGGG - Intergenic
1199134383 X:144233565-144233587 TTGAGGGCTCAGAAAGATGAGGG + Intergenic
1199242274 X:145561180-145561202 TTGGAGACTTAGAAGGGGAAGGG + Intergenic
1199516987 X:148689146-148689168 GTGAAGACACAGAAAGAAGATGG - Intronic
1200109377 X:153732532-153732554 TGGGTGACTCACCAAGAGGAAGG + Intronic
1200377259 X:155796259-155796281 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1200441191 Y:3214291-3214313 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1200442560 Y:3228985-3229007 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200529582 Y:4318147-4318169 TTAGAGATTTAGAAAAAGGATGG - Intergenic
1200586318 Y:5008948-5008970 TTATAGACTCTGAAAGTGGAAGG + Intronic
1200686071 Y:6261103-6261125 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200697388 Y:6373015-6373037 TGGGAGACTCATAAAAAAGAAGG + Intergenic
1200806212 Y:7436191-7436213 TTGGAGACTCCAAAGTAGGAAGG - Intergenic
1200835101 Y:7725265-7725287 CTGGGGACTCAGACACAGGATGG + Intergenic
1200991607 Y:9352350-9352372 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200994263 Y:9372626-9372648 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1200996927 Y:9392966-9392988 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200999442 Y:9461518-9461540 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201002097 Y:9481824-9481846 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1201004762 Y:9502110-9502132 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201007415 Y:9522436-9522458 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201010023 Y:9542288-9542310 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201036725 Y:9791684-9791706 TGGGAGACTCATAAAAAAGAAGG - Intergenic
1201398708 Y:13578624-13578646 TTGGAAACTCAGAATAGGGAAGG + Intergenic
1201504709 Y:14685422-14685444 ATTGAGAGTCAGAGAGAGGAAGG - Intronic