ID: 992411661

View in Genome Browser
Species Human (GRCh38)
Location 5:76511111-76511133
Sequence CAGAATGTAGTCCATATAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992411661_992411666 9 Left 992411661 5:76511111-76511133 CCTATTATATGGACTACATTCTG 0: 1
1: 0
2: 1
3: 8
4: 130
Right 992411666 5:76511143-76511165 AAGGAAAACCTTGGTTGCGATGG 0: 1
1: 0
2: 0
3: 12
4: 149
992411661_992411663 -10 Left 992411661 5:76511111-76511133 CCTATTATATGGACTACATTCTG 0: 1
1: 0
2: 1
3: 8
4: 130
Right 992411663 5:76511124-76511146 CTACATTCTGCCATAAGGAAAGG 0: 1
1: 0
2: 0
3: 11
4: 143
992411661_992411665 0 Left 992411661 5:76511111-76511133 CCTATTATATGGACTACATTCTG 0: 1
1: 0
2: 1
3: 8
4: 130
Right 992411665 5:76511134-76511156 CCATAAGGAAAGGAAAACCTTGG 0: 1
1: 0
2: 1
3: 30
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992411661 Original CRISPR CAGAATGTAGTCCATATAAT AGG (reversed) Intronic
902441889 1:16435891-16435913 GAAAATGTAATCCACATAATGGG - Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
907961298 1:59284042-59284064 CAAAAGGTACTCCATAAAATTGG + Intergenic
908684661 1:66702070-66702092 CAGAATGTAGCCCGTATTAAGGG - Intronic
909375331 1:74934818-74934840 CACAATGTTGTACACATAATAGG + Intergenic
909443083 1:75719525-75719547 CAGGATTTAGTCCAAATTATAGG - Intergenic
913359399 1:117963232-117963254 CAGAATACAGTAAATATAATGGG + Exonic
913368867 1:118074047-118074069 CAGTATGTACTCCATCTAATTGG + Intronic
915177364 1:154027144-154027166 CTGAATGTATTTCATATAAATGG - Intronic
916401277 1:164451663-164451685 CATAATGTAGTACGTATATTGGG - Intergenic
917364613 1:174216251-174216273 GTGAATGTAGTCAATTTAATTGG + Intronic
917479602 1:175400614-175400636 CAGAATGCAATCCACACAATGGG + Intronic
919081658 1:192874408-192874430 CAGTATGTGGTCCTCATAATTGG + Intergenic
919512565 1:198484006-198484028 AAGAATCTAGTCCACAGAATAGG - Intergenic
920003674 1:202816802-202816824 TATCATGTAGTCCCTATAATTGG + Intergenic
921623813 1:217356070-217356092 CAGAATGTAGACTAGACAATTGG + Intergenic
1063282093 10:4641261-4641283 CAGAATGTTGTGCATACAACAGG - Intergenic
1064497593 10:15929861-15929883 CAGAATGTAATCCCTATGACAGG - Intergenic
1065083168 10:22147215-22147237 AAGAACTTAGTCCATCTAATAGG - Intergenic
1066543646 10:36475943-36475965 CATAATGTCGTCAATGTAATGGG - Intergenic
1067773201 10:49142226-49142248 TAAAATGCAGCCCATATAATGGG - Intergenic
1070017975 10:72553818-72553840 CAAAATATATACCATATAATAGG - Intronic
1071202584 10:83236525-83236547 CAAAATGTTCTCCACATAATTGG - Intergenic
1071565154 10:86667856-86667878 CAGAATGCATGCCAGATAATGGG - Intergenic
1078237696 11:9501556-9501578 CAGCATCTTGTCCATATAATGGG - Intronic
1079646090 11:22865094-22865116 CAGAATGTCCTCCATATTATGGG + Intergenic
1079744807 11:24111659-24111681 CAGAGTGAAGTTAATATAATAGG - Intergenic
1087150592 11:94856103-94856125 CTGAATGTATTTCATATCATAGG - Intronic
1088085644 11:105976127-105976149 CAGAATTCAGTCCAAATAATTGG - Intronic
1092601322 12:10068898-10068920 ATGAAAGTAGTTCATATAATAGG - Intergenic
1093052482 12:14519159-14519181 CAGAATTCAGTCCATATCACGGG - Intronic
1096672174 12:53206582-53206604 CAGAATGGAGTCCAGAAAAATGG - Intronic
1097524741 12:60717676-60717698 CAGAATGTAGACATTCTAATAGG - Intergenic
1103970495 12:124667767-124667789 CAGAAGGTAGTTCAGATAATGGG + Intergenic
1109305009 13:60628765-60628787 CAGAATGTAACCAATATATTTGG + Intergenic
1109953273 13:69530654-69530676 CAGGTTGTAGTCCTTATATTTGG - Intergenic
1110168740 13:72474785-72474807 CAGGATGTCATCAATATAATAGG - Intergenic
1111208660 13:85047554-85047576 CAAAAGGAAGCCCATATAATGGG + Intergenic
1114819194 14:25995909-25995931 CAGAATCTGGTTCATAAAATAGG + Intergenic
1116962561 14:50981704-50981726 CTGAATGTGGTCTATGTAATAGG + Intronic
1117617666 14:57550290-57550312 CAGAATGCAGTGAAAATAATGGG + Intergenic
1117831348 14:59754443-59754465 CAGAATGGAGTTCATTCAATTGG + Intronic
1121186610 14:91977885-91977907 CAAAATGTCATTCATATAATAGG + Intronic
1121807698 14:96845460-96845482 ATGAATGTAGTCCATAACATTGG + Intronic
1123714438 15:23015871-23015893 CAAAACGTACTCCATAAAATTGG + Intronic
1130711204 15:86282858-86282880 CTAAATGTAATCCATATTATAGG - Intronic
1133637204 16:7678942-7678964 AATACTGTTGTCCATATAATTGG + Intronic
1138361181 16:56428810-56428832 CTGTGTGTAGTCCATATCATTGG - Intergenic
1149427022 17:56565108-56565130 CATAATGTCATCAATATAATGGG - Intergenic
1149510517 17:57237334-57237356 CACACTGTTTTCCATATAATGGG + Intergenic
1153586945 18:6631799-6631821 CAGAATGTGGCCCATAGAGTGGG - Intergenic
1153639725 18:7146471-7146493 AAGAATGTAGTTCACATAAGAGG - Intergenic
1154228073 18:12526680-12526702 TAAAATGTCTTCCATATAATGGG - Intronic
1154252469 18:12755925-12755947 CTGAATGGTGTCCATAGAATGGG + Intergenic
1156073231 18:33238163-33238185 CATAACGTACTCCATAAAATCGG + Intronic
1157168583 18:45381605-45381627 GAGCTTATAGTCCATATAATTGG - Intronic
1163048358 19:14662005-14662027 CAGAATGCAGTCTATATCCTGGG + Exonic
1165218433 19:34294636-34294658 AAGAATATAGCCCATATAAAGGG - Intronic
1167840720 19:52116451-52116473 CACAAGGTAGTCCATACAAGAGG - Exonic
926497623 2:13611099-13611121 CAGAATGTTATACATATATTTGG - Intergenic
928481291 2:31686866-31686888 CAGTATGTAATACATATAACAGG + Intergenic
929231348 2:39564158-39564180 CAGAAGCTAATCCATAAAATTGG - Intergenic
929903307 2:46024518-46024540 CAGTATGTAATCCATTTTATCGG + Intronic
932072073 2:68630558-68630580 AAGAAGGTAGTTCTTATAATGGG - Intronic
940059746 2:149551811-149551833 CAGTATGTAGTCAAAAGAATTGG - Intergenic
942377180 2:175349500-175349522 CCAAATGTAGTACAAATAATTGG - Intergenic
942398550 2:175577171-175577193 CAGTATGGTGTCCAGATAATAGG - Intergenic
945009934 2:205450181-205450203 CAGACTGTATTACATATTATTGG + Intronic
945662152 2:212699859-212699881 TAGAATGTGTTCCATACAATAGG - Intergenic
1168801815 20:648362-648384 CTGAATGTAGTCCATATAAGAGG + Exonic
1178774026 21:35531774-35531796 CAGAATATATTGCATATAACTGG - Intronic
1178808372 21:35858623-35858645 CAGAATGGAGTGCTTATATTAGG - Intronic
1183029096 22:35088840-35088862 CAGAATGTGTTCCTTATAAAAGG + Intergenic
1183920911 22:41167309-41167331 CAAAAGGTAGCCCATATAAATGG - Intronic
951316742 3:21196443-21196465 CTGAATGTAGTGCATAAAAAAGG - Intergenic
951564396 3:23998563-23998585 CAAAATGTCCTCCATAGAATAGG - Intergenic
952150969 3:30591271-30591293 CAGAATGGAGTGCATAGAATTGG + Intergenic
952227601 3:31394836-31394858 AAAAATGTAGTCAATATTATGGG + Intergenic
952890413 3:38036676-38036698 AAGAATGTAGTCAATAGAACGGG + Intergenic
953045329 3:39289631-39289653 CATAATTCAGTCCATATACTTGG - Intergenic
953835066 3:46335356-46335378 CAGATTGAAGTCCATAAACTTGG + Intergenic
955755154 3:62218640-62218662 CAGAATGCAGCCCATAGAAGAGG + Intronic
956256164 3:67285427-67285449 CAGTATGTAGACTATATACTGGG - Intergenic
957425623 3:80035457-80035479 CAGAAAGTAGTTCATGAAATAGG - Intergenic
962323533 3:134412097-134412119 GAGAATGTAGTTCATAAAACAGG - Intergenic
964998841 3:162926059-162926081 TAGACTGTAGTCTATATAAAAGG + Intergenic
966460202 3:180168217-180168239 CAAAATTTACTCCATAAAATTGG - Intergenic
971682508 4:29719000-29719022 GAAAATGTACTCAATATAATAGG + Intergenic
972090691 4:35278477-35278499 CAGAATCTAATCCATAAGATAGG - Intergenic
973725954 4:53776097-53776119 CGGAAAGTAGGCCAAATAATTGG + Intronic
973942779 4:55927088-55927110 CAGAACCTAGTACATATAAGAGG + Intergenic
976732893 4:88282558-88282580 CAGAATGTATTTCAGCTAATTGG + Intronic
978746730 4:112203214-112203236 TAGAATGTAGTCCATGTACAAGG + Intergenic
980338062 4:131501176-131501198 CAGAATGTTCTCCATAAAAAAGG + Intergenic
981023943 4:140056952-140056974 CAGAATGGACCCCATGTAATAGG - Intronic
981977168 4:150744833-150744855 CAGAATATAGTAAAGATAATGGG + Intronic
984141314 4:176006865-176006887 CAGAATGCAGTCCAAATTGTAGG + Intergenic
986509516 5:8489525-8489547 CAGAATGTGATGCATATCATAGG - Intergenic
986511232 5:8508431-8508453 GGAAATGTAGTCCATATCATGGG + Intergenic
987489356 5:18556906-18556928 CAGAATTTGGTCCAAATTATGGG - Intergenic
988188881 5:27902002-27902024 CTGAGTGGAGTCCACATAATAGG - Intergenic
988195948 5:28005751-28005773 CGGAATGTATTCCATATGTTTGG - Intergenic
990234163 5:53748966-53748988 CAGAATGTACTTCAGATTATAGG - Intergenic
990236958 5:53778806-53778828 CAAAAGGTAGTTCATATACTAGG + Intergenic
990245714 5:53861554-53861576 CAGAATGTAGTATATATACATGG - Intergenic
990811424 5:59728688-59728710 CACAATATAGTACATAAAATTGG + Intronic
991286426 5:64982247-64982269 CAGTATGTATTACATATAAAAGG - Intronic
992411661 5:76511111-76511133 CAGAATGTAGTCCATATAATAGG - Intronic
995950911 5:117712826-117712848 TAGCATGAAGTGCATATAATAGG - Intergenic
999552611 5:152705610-152705632 GAGTATCTAGTCCATAGAATTGG - Intergenic
1003207367 6:4025354-4025376 CATAATGTATTACATACAATGGG - Intronic
1003299777 6:4868554-4868576 CAGAATGTAGGCCATAAAACAGG - Intronic
1003394616 6:5742469-5742491 TAGAAGGTACTACATATAATGGG - Intronic
1007844759 6:44744194-44744216 CAGGATGTAGTCCAAATTGTAGG + Intergenic
1008381346 6:50842429-50842451 CAGACTGTTGTCAATATAAAAGG - Intronic
1012090764 6:94893063-94893085 CAGAATATAGTTTATATATTAGG - Intergenic
1016651582 6:146467495-146467517 CTGAATGTAGTCAATTTTATTGG + Intergenic
1018208134 6:161454723-161454745 CAGAAAGTAGTCAACCTAATGGG - Intronic
1018652099 6:166001169-166001191 CAGAATGTATTTAAGATAATTGG - Intergenic
1018696752 6:166396782-166396804 CAGCATGTGGTCCACATACTGGG - Intergenic
1020229907 7:6310189-6310211 CAAAGTGTAGTCCATAAACTGGG + Intergenic
1021916402 7:25437606-25437628 CAGAATGTTGGCCCTATAAGTGG + Intergenic
1024197691 7:47075361-47075383 CAGAATATTGTCCTTAAAATAGG - Intergenic
1028971252 7:96860734-96860756 CAGAATGTAGTAAAGACAATCGG - Intergenic
1031452422 7:121938224-121938246 CAGAATGTAATACACATCATAGG + Intronic
1031644204 7:124203311-124203333 CAAAATTTAGTCCAATTAATAGG + Intergenic
1037944482 8:22978632-22978654 CAGAATGTATTCCACGTAACAGG + Intronic
1041541853 8:58993778-58993800 GAGAATGCAATCCATATAAAAGG - Intronic
1041980452 8:63852480-63852502 TAGAATGTTGTCCATAGAAAAGG + Intergenic
1043992804 8:86776935-86776957 GAGAGTGTAGTCAATAGAATTGG + Intergenic
1051190713 9:14509013-14509035 CAGAATGTATTCCATTTCCTGGG - Intergenic
1056493918 9:87136884-87136906 TAGAATCTAGTCCATATACCAGG - Intergenic
1056615657 9:88163291-88163313 CAGAATGTATCACATGTAATAGG + Intergenic
1186023224 X:5280410-5280432 CAGAGTGTAGGCTATATAAGAGG + Intergenic
1188508983 X:30913168-30913190 CATAATGTCATCAATATAATGGG - Intronic
1191818568 X:65275709-65275731 CAAAATGTACTCCATAAAATTGG + Intergenic
1193895364 X:87109211-87109233 CAGATTGTAGTACATAGAACTGG + Intergenic
1195366543 X:104131997-104132019 CAGATTGTATTCAGTATAATAGG - Intronic
1196428897 X:115601243-115601265 AAGGGTGTAGTACATATAATGGG + Intronic
1196889225 X:120276226-120276248 CAGTAGGTACTCCATATAGTAGG - Intronic