ID: 992414839

View in Genome Browser
Species Human (GRCh38)
Location 5:76542424-76542446
Sequence GCTTCGTTCCTTACCGGTAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 16
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 14}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992414831_992414839 -9 Left 992414831 5:76542410-76542432 CCCCCACCCAGCCAGCTTCGTTC 0: 1
1: 0
2: 0
3: 19
4: 294
Right 992414839 5:76542424-76542446 GCTTCGTTCCTTACCGGTACCGG 0: 1
1: 0
2: 0
3: 1
4: 14
992414830_992414839 6 Left 992414830 5:76542395-76542417 CCAAGTTGCTTACAGCCCCCACC 0: 1
1: 0
2: 0
3: 14
4: 143
Right 992414839 5:76542424-76542446 GCTTCGTTCCTTACCGGTACCGG 0: 1
1: 0
2: 0
3: 1
4: 14
992414829_992414839 29 Left 992414829 5:76542372-76542394 CCACAAGTAGCTGTGAGCTAGAG 0: 1
1: 0
2: 0
3: 17
4: 141
Right 992414839 5:76542424-76542446 GCTTCGTTCCTTACCGGTACCGG 0: 1
1: 0
2: 0
3: 1
4: 14
992414832_992414839 -10 Left 992414832 5:76542411-76542433 CCCCACCCAGCCAGCTTCGTTCC 0: 1
1: 0
2: 11
3: 57
4: 516
Right 992414839 5:76542424-76542446 GCTTCGTTCCTTACCGGTACCGG 0: 1
1: 0
2: 0
3: 1
4: 14

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992414839 Original CRISPR GCTTCGTTCCTTACCGGTAC CGG Intronic
906881295 1:49594265-49594287 GCTTCCTCCCTTTCCTGTACAGG - Intronic
907564730 1:55424199-55424221 CCTTCCTTCCTTCCCGGTACGGG - Intergenic
1076401019 10:130185413-130185435 GCTTTCTTCCTTCCAGGTACAGG + Intergenic
1102162615 12:110781842-110781864 GCTTCCTTCCTCCCCGCTACTGG - Intergenic
1114890467 14:26915289-26915311 GCTTGGTTCCTAAGCCGTACGGG + Intergenic
1115852075 14:37596432-37596454 GCTTGGTTCCTAATCGGTCCTGG + Intronic
1122900183 14:104779171-104779193 GCTTTATTCCTTACCTGTAGCGG - Intronic
1162854815 19:13460160-13460182 GCTGCATTCCTAACCGGTGCTGG - Intronic
1166572438 19:43806091-43806113 GCCCCGTTCCTAACAGGTACTGG - Intronic
946099682 2:217309255-217309277 GCCTGGTTCCTAACTGGTACTGG + Intronic
1175202646 20:57288822-57288844 GCTACGTTCCTTCCAGGAACTGG + Intergenic
1185214812 22:49592631-49592653 GCTTTGGTCCTGACCTGTACGGG - Intronic
984947293 4:184979760-184979782 GCTTCGTTCCTTCCCTCTGCGGG - Intergenic
987070817 5:14335419-14335441 GCTCCGTTCCTTTCCTGTCCTGG + Intronic
992414839 5:76542424-76542446 GCTTCGTTCCTTACCGGTACCGG + Intronic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic