ID: 992416026

View in Genome Browser
Species Human (GRCh38)
Location 5:76552046-76552068
Sequence AACGAAAGTGTTCAGGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992416026_992416035 27 Left 992416026 5:76552046-76552068 CCCTGGGCCTGAACACTTTCGTT 0: 1
1: 0
2: 0
3: 9
4: 74
Right 992416035 5:76552096-76552118 CCATTCTTCCTTTTTCTTGAAGG 0: 1
1: 1
2: 23
3: 83
4: 663
992416026_992416032 2 Left 992416026 5:76552046-76552068 CCCTGGGCCTGAACACTTTCGTT 0: 1
1: 0
2: 0
3: 9
4: 74
Right 992416032 5:76552071-76552093 GGGGTGAGAGTAGTAGCTTTAGG 0: 1
1: 0
2: 2
3: 12
4: 126
992416026_992416033 3 Left 992416026 5:76552046-76552068 CCCTGGGCCTGAACACTTTCGTT 0: 1
1: 0
2: 0
3: 9
4: 74
Right 992416033 5:76552072-76552094 GGGTGAGAGTAGTAGCTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992416026 Original CRISPR AACGAAAGTGTTCAGGCCCA GGG (reversed) Intronic