ID: 992418707

View in Genome Browser
Species Human (GRCh38)
Location 5:76579528-76579550
Sequence TTATTTCAGGGTAATGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992418707 Original CRISPR TTATTTCAGGGTAATGGGGA AGG (reversed) Intronic
901595142 1:10379074-10379096 TAATTTCAGGGAAATGAAGATGG + Intronic
903457874 1:23500780-23500802 TTATTTAAGGTTGTTGGGGAGGG - Intergenic
903996874 1:27311293-27311315 TAATTTGAAGGTAATGGGGCAGG + Intergenic
904668058 1:32139301-32139323 TTGGGTTAGGGTAATGGGGAAGG + Intronic
904797307 1:33066371-33066393 TTATTTTATAGTAATTGGGAGGG - Intronic
905175784 1:36134534-36134556 TTACATCAGGGGAATGGGGCTGG + Intergenic
905838596 1:41152848-41152870 TTAGTTAAGGGTAGTGGGAAAGG - Intronic
906338772 1:44959225-44959247 TTAAATCAGGGTGATGGAGATGG + Intronic
907159043 1:52358101-52358123 AGACTGCAGGGTAATGGGGATGG + Intronic
907708419 1:56853064-56853086 TTATTTCAGGGATCAGGGGAAGG + Intergenic
907897897 1:58709912-58709934 TGATTTCAGGGAATTGGGGAGGG - Intergenic
908133849 1:61106785-61106807 GAATTTCAGGGTAATGGGAGAGG - Intronic
910917578 1:92306979-92307001 TTACTTCTGGGGAATGCGGAGGG + Intronic
911003310 1:93190584-93190606 TTATTTCTGGGTGATGGTTAGGG + Intronic
912861318 1:113216393-113216415 TTCTTTGAAGGTAATGGGGTAGG - Intergenic
913065831 1:115253847-115253869 TTATTTCAGGGTCAGGGATAAGG + Intergenic
917132452 1:171756670-171756692 TTATTACAGGGCATTGGAGAGGG - Intergenic
918764036 1:188455582-188455604 TTATTCCAGGTGAATGGAGATGG - Intergenic
919224366 1:194675892-194675914 TTATTTCTAGGTAGTGGGGGAGG - Intergenic
920839194 1:209539628-209539650 TTTTTTCTGGGCACTGGGGATGG + Intergenic
920913381 1:210237807-210237829 ATGTTTCAGGGTAAAGGGGAGGG + Intronic
921353520 1:214262342-214262364 GTAGTACAGGGTAATGGGTAAGG + Intergenic
922213496 1:223502662-223502684 GGCTTTCAGGGGAATGGGGAAGG + Intergenic
923696026 1:236253330-236253352 TTATTTCAGGCTAATGTCAATGG - Intronic
923922652 1:238585888-238585910 GCATTTCAGGGTAATGGGGTAGG - Intergenic
924390899 1:243555645-243555667 TTATTTCATGGTTATTGTGAGGG + Intronic
924795445 1:247289203-247289225 CTCTTTAAGGGTAATGCGGACGG - Intergenic
1062832224 10:613593-613615 CTAATTCATGGTAATTGGGATGG + Intronic
1065142345 10:22730346-22730368 TTATTTCAGGGGTTTGGGGATGG + Intergenic
1065463057 10:25989863-25989885 GTATGTCAGGGTGATGGGCAGGG + Intronic
1065713864 10:28545150-28545172 TTGATTCTGGGTAATGGGGAGGG - Intronic
1066336850 10:34486408-34486430 TTGTTTCAGGGCAATGGTGGTGG + Intronic
1066671597 10:37846134-37846156 TTATTGCAGGGCATTGGGCAAGG - Intronic
1067010145 10:42703573-42703595 ATATCTCAGGATAATGAGGAAGG + Intergenic
1070845017 10:79514540-79514562 CTATTTCTGGGGAATGGGCAGGG - Exonic
1070928787 10:80245769-80245791 CTATTTCTGGGGAATGGGCAGGG + Intergenic
1072558767 10:96548910-96548932 TTACTTGAGGGACATGGGGAGGG - Intronic
1078401278 11:11029468-11029490 TCATTTGAGTGAAATGGGGATGG - Intergenic
1078801530 11:14649702-14649724 TTATTTCAGAGTAATTTGTAAGG + Intronic
1078973561 11:16444623-16444645 TGTTTTCAGGGTAAGAGGGAGGG - Intronic
1080022678 11:27579710-27579732 TTATTGGAAGGGAATGGGGATGG + Intergenic
1080679867 11:34464468-34464490 TTATTGAAGGGATATGGGGAGGG + Intronic
1082265343 11:50111835-50111857 TTATTTCTGGATTCTGGGGATGG - Intergenic
1084360451 11:68665512-68665534 TTATTTCTGGGTCATTGTGATGG - Intergenic
1086148582 11:83582597-83582619 ATATTGCTGGGGAATGGGGATGG - Intronic
1086942993 11:92817189-92817211 TTGTTTCAGGGTGAGGGGAAAGG + Intronic
1090239572 11:125172480-125172502 TGATATCAGGGTGATCGGGATGG + Intronic
1090429762 11:126635924-126635946 TTATTTTTGGGTCATGGGCAGGG + Intronic
1090880644 11:130829066-130829088 TTACTTCAGGGTAATGGTCGAGG + Intergenic
1093455084 12:19357200-19357222 CTATTTCAGGGTCATGGGACTGG + Intronic
1095924930 12:47568911-47568933 TCATATCAGGGTAACTGGGAGGG + Intergenic
1096993145 12:55821317-55821339 TTATATCAGGATAAAGGAGAGGG + Exonic
1099861625 12:88230425-88230447 GTTTTTAAGGGTAATGCGGATGG - Intergenic
1100100192 12:91093898-91093920 TTATTTCAGGGATGTGAGGATGG + Intergenic
1102092419 12:110202952-110202974 TTATTTCTGGGAAATGGTGAGGG - Intronic
1102753933 12:115321353-115321375 TTATTTTAGGGGAAAGGGAAAGG - Intergenic
1105446849 13:20464904-20464926 TTCTTTCAGGGATATGGCGAAGG - Intronic
1105893589 13:24699492-24699514 TTTTTTCAGGGTGATGGGAATGG + Intronic
1107814983 13:44236664-44236686 CTACTGCAGGGGAATGGGGAGGG + Intergenic
1108507148 13:51122711-51122733 TTATTTCAGGGGAATTGATAAGG - Intergenic
1108888266 13:55218881-55218903 TTACTGCAGGGTGATGGTGAAGG - Intergenic
1110906085 13:80891625-80891647 TCATTACAGGGGACTGGGGAGGG + Intergenic
1111007411 13:82266038-82266060 TAATTTCAGGGAAATGGAGAGGG - Intergenic
1111251075 13:85602087-85602109 TTATTTCAGGGGAATTTGAAAGG + Intergenic
1111262984 13:85767203-85767225 TGGTTTCTGGGGAATGGGGAAGG + Intergenic
1112869585 13:103953690-103953712 TAATTTCATTGAAATGGGGAGGG - Intergenic
1112944297 13:104907560-104907582 TTATCTCAGGGATATGGGGATGG - Intergenic
1112983692 13:105419711-105419733 CTATTTCGGGGTTGTGGGGAGGG + Intergenic
1113777786 13:112958587-112958609 GCATTTCAGGGAAATGAGGAAGG - Intronic
1114343573 14:21771315-21771337 GTAGACCAGGGTAATGGGGATGG + Intergenic
1114627535 14:24139183-24139205 CTATTTCAGAGTGATGTGGAGGG - Exonic
1117561274 14:56941924-56941946 GTCTTTCAGGGTGAGGGGGAAGG - Intergenic
1117739945 14:58806828-58806850 CTCTTTCTGGGTCATGGGGATGG + Intergenic
1117748495 14:58896550-58896572 ATAATTCAGGGGAATGGGGAAGG - Intergenic
1118942013 14:70347076-70347098 CTCTTTAAGGGTAATGCGGACGG - Intronic
1119517018 14:75256437-75256459 TTATTACAGGATTATGGGCAAGG - Intronic
1120076840 14:80168375-80168397 TTATTTTAGGGTAGTGGGAATGG - Intergenic
1120562369 14:86011152-86011174 TTTTAGCAGGGTAATAGGGAAGG + Intergenic
1121718115 14:96090583-96090605 TGATTTCATGGGAAAGGGGAAGG - Exonic
1122117103 14:99533222-99533244 TCCTTTCAGGGTACTGGGTATGG + Intronic
1122128930 14:99593951-99593973 TTATTCAGGGGAAATGGGGAAGG + Intronic
1127484268 15:59404895-59404917 TTATTTCAGGGTGATGGTTAGGG - Intronic
1127787543 15:62369264-62369286 TTAGTTCAAGGTAGTGGAGAAGG + Intergenic
1128499515 15:68218133-68218155 CTATCCCAAGGTAATGGGGAAGG + Intronic
1128917760 15:71580161-71580183 TTATTTCAGGGAAATGGGCATGG + Intronic
1128989135 15:72244107-72244129 CTAGTTAAGGCTAATGGGGAAGG - Intronic
1129410962 15:75350016-75350038 TTGTTTCAAGGGGATGGGGAGGG + Intronic
1129551235 15:76451892-76451914 TTATTATAGGGTATTGGGAAAGG + Intronic
1129702339 15:77775090-77775112 CTATTGCAGGGAACTGGGGATGG + Intronic
1130655853 15:85791804-85791826 TTTTTTCAGGGGTATGGTGAAGG - Intronic
1131073431 15:89480020-89480042 TTCTTTCAGCTTCATGGGGAAGG + Intronic
1131457509 15:92594559-92594581 TTATTTCAGTGTATGAGGGAGGG - Intergenic
1132294763 15:100726844-100726866 TGAAATCAGGGTAATGGGGATGG - Intergenic
1133568140 16:7014656-7014678 GTCTTTCAAGGTAATGGGAATGG + Intronic
1138266614 16:55664305-55664327 TTCTTTCTAGGTAATGGGGCTGG + Intronic
1139729347 16:68929381-68929403 TTAATTTAGGGTAATGGCCATGG - Intronic
1140736415 16:77901780-77901802 TTATTTCAGGTTAGGGGTGAGGG - Intronic
1144128711 17:12225401-12225423 TGATTTCATAGGAATGGGGAGGG + Intergenic
1146565661 17:33910810-33910832 TTACCTCAGGGTGTTGGGGAAGG + Intronic
1148771982 17:50072602-50072624 TTATATTTGGGTAATGGTGATGG + Intronic
1149077458 17:52613328-52613350 TTTTTTCAGGGTGAGGGGGTTGG + Intergenic
1150554110 17:66238217-66238239 TGATTTCGGGGAAAAGGGGAAGG - Intronic
1150992513 17:70276113-70276135 TTGTTGCTGGATAATGGGGAGGG + Intergenic
1157605839 18:48925444-48925466 TGCTTTAAGGGAAATGGGGAAGG - Intronic
1157696616 18:49728477-49728499 TTATTTCCTGGTAAAGGTGAAGG + Intergenic
1157887397 18:51382265-51382287 TTATCTCAGAGTAATGGTGTTGG + Intergenic
1158684159 18:59597970-59597992 GAATTTCAAGGGAATGGGGAGGG + Intronic
1160255705 18:77247012-77247034 TTGGTTCAGGAAAATGGGGATGG - Intergenic
1164330011 19:24245245-24245267 TTATTTTACAGTAATTGGGAGGG - Intergenic
1164898886 19:31901284-31901306 TTATTTCAGGGGGAAGGAGATGG - Intergenic
1165138752 19:33686919-33686941 CTATTGCACGGTCATGGGGACGG - Intronic
1165392134 19:35544997-35545019 TCATTTCATGGTAAGGGGGAAGG + Exonic
1166865095 19:45831080-45831102 TTAGTTCGTGGTAATGGTGATGG - Intronic
1168157062 19:54480395-54480417 TTTTTTAAGGGTTATTGGGATGG + Intergenic
1168455475 19:56504365-56504387 TTATTTCTGGAGAATGAGGATGG - Intergenic
927684105 2:25158991-25159013 TTATTTTAGGGAAGTGGGAAAGG + Exonic
928736464 2:34296699-34296721 TTATTTCAGGGTAAGCAGGGAGG - Intergenic
929308624 2:40396024-40396046 TAATTTCATGGAAATGGGAAAGG + Intronic
931054855 2:58457959-58457981 TCATTTTAGGGGAATGGGGTGGG + Intergenic
932912460 2:75819716-75819738 TTATTTCAAATTAATGTGGAAGG + Intergenic
932993685 2:76821014-76821036 TTATTTCAGGATACTGTGCAAGG + Intronic
933194004 2:79368710-79368732 CCATTTCAGGGTAAAGGGAAGGG - Intronic
933216590 2:79637016-79637038 TAATTTCAGTGGAATGGTGAGGG + Intronic
934519909 2:95013611-95013633 TCATCCCAGGGTTATGGGGATGG - Intergenic
936767318 2:115868594-115868616 ATATTTCAGGGGCAGGGGGAGGG + Intergenic
939139514 2:138336694-138336716 TTCTTTCTGGGTGATAGGGAAGG - Intergenic
940661124 2:156546494-156546516 GTATCTCAGGGTAAGGGGTAAGG + Intronic
940678492 2:156754186-156754208 TTATGTCAGAGAAATGGGGAGGG - Intergenic
941829074 2:169934283-169934305 TTTTTTCAGGGTAGTGATGATGG + Intronic
942982457 2:182099003-182099025 TTATTGCAAGGTGATGGGGGAGG + Intronic
943088576 2:183346899-183346921 TTATCTCAGGTTTGTGGGGAAGG + Intergenic
943812432 2:192204998-192205020 ATATTTCAGTGTTATGTGGATGG + Intergenic
943874146 2:193040810-193040832 TTATTTCAGGTTAATTTGCATGG - Intergenic
944794069 2:203164359-203164381 TATTTTCAGGGTACTGGGTAGGG + Intronic
945442087 2:209892197-209892219 TTAGTCCAGGGAAAAGGGGATGG + Intronic
947393000 2:229658600-229658622 TTATTTAAGGGTACTTGGGGAGG + Intronic
948862213 2:240758146-240758168 TTATTTCAGGGGACGTGGGATGG - Intronic
1170034091 20:11972006-11972028 TTATTTCAAGGAAAAGGGGCAGG - Intergenic
1170652646 20:18256926-18256948 CTGTTCCAGGGTTATGGGGATGG - Intergenic
1172136322 20:32689274-32689296 TTATTTCAGGGAAAAGGAGTAGG - Intergenic
1172207339 20:33173298-33173320 TAATTTCAGGGTCAGGGTGAAGG + Intronic
1174995034 20:55557430-55557452 TTATGTCAAGGTCATGGCGATGG - Intergenic
1175458948 20:59136447-59136469 TACTTTCTGGGTAATGTGGAAGG - Intergenic
1177721087 21:24907878-24907900 ATCTTTCAGGGTAATCGGCATGG - Intergenic
1178011938 21:28297555-28297577 TGATTTCAAGGTAATGTGGAGGG - Intergenic
1178296936 21:31417996-31418018 TTATTTCGGGGCAATTGGAAAGG + Intronic
1184319648 22:43730669-43730691 TTATTTCTGGGTAGTGGGCTTGG + Intronic
1184707657 22:46225293-46225315 TGATTTGAGGGTAACAGGGATGG + Intronic
949388637 3:3534921-3534943 TTATTTAAGGAGAATGAGGAAGG - Intergenic
950410400 3:12832576-12832598 AGATTTCAGGGTCATGGGTAAGG - Intronic
952214185 3:31259686-31259708 ATATTTCAGGACAATGGGAAAGG - Intergenic
952912847 3:38205143-38205165 CTACTTCTGGGAAATGGGGAAGG + Intronic
953342240 3:42144548-42144570 TTGTTTTATGGTAATGGGGTAGG + Intronic
955941879 3:64153895-64153917 TTATTTTAAGGCAATAGGGAAGG - Intronic
957230138 3:77502843-77502865 TATTTTCAGGGTTGTGGGGATGG + Intronic
958031541 3:88116708-88116730 TTACCTCTGGGTAATGGGGCTGG - Intronic
964821504 3:160775372-160775394 ATATTTCAAGGTTATGGGAATGG + Intronic
967107651 3:186267283-186267305 TCATTTCAGGGTACTCGGGGTGG + Intronic
970490858 4:16572200-16572222 GTATATCAGGAAAATGGGGAGGG - Intronic
971906302 4:32731165-32731187 TTATGTCATGGTAGTGGGTATGG - Intergenic
973822789 4:54677420-54677442 GTATTTCAGGGATATGGGGAAGG + Intronic
973910174 4:55572095-55572117 TTATTTCAGTGGAATTGGGCAGG + Intronic
975665662 4:76732544-76732566 TTCTTTCAGGGTGATTGGGAAGG - Intronic
976299923 4:83507733-83507755 CTGTTTAAGGGTAATGTGGACGG + Intronic
979724794 4:123947979-123948001 TCATTTCAGGGTGATCAGGAAGG + Intergenic
985983075 5:3488463-3488485 TTATTTAATTGAAATGGGGAGGG - Intergenic
986317465 5:6600117-6600139 TTATCTCAGGATGATGGGGCTGG - Exonic
986937792 5:12912809-12912831 TTATTTCGAGGTAATGGCTAGGG + Intergenic
987641428 5:20616780-20616802 TTATTTAAGGGTATTGTGAAAGG - Intergenic
987797148 5:22642419-22642441 TCATCTCAAGGTTATGGGGAAGG - Intronic
988267388 5:28968915-28968937 TGATTTCAGGGAAAGGAGGAAGG - Intergenic
989058854 5:37390072-37390094 TTATCTCAGGTTATTGAGGATGG + Intronic
989129562 5:38093280-38093302 TTATTTTAGGGTAATGGCAGTGG - Intergenic
990185153 5:53203441-53203463 CTCTTTAAGGGTAATGCGGACGG - Intergenic
990646823 5:57854780-57854802 TTATTTAATGGAAATGAGGAGGG - Intergenic
991771026 5:70041338-70041360 TTAGTTCAGGGGAATGGGACTGG - Intronic
992418707 5:76579528-76579550 TTATTTCAGGGTAATGGGGAAGG - Intronic
993238473 5:85346892-85346914 TCATCTCAGGGTTATGGAGATGG - Intergenic
993610782 5:90051789-90051811 TTATATCTGGGAAATGGTGAGGG + Intergenic
994763336 5:103884387-103884409 TCATTTCAGGGTAATGCTCAGGG + Intergenic
994817871 5:104607617-104607639 TTATTATAGGGGAATGGGGTGGG + Intergenic
995509283 5:112892134-112892156 GGATTTCAGAGTAATGGAGAAGG + Exonic
995991640 5:118247058-118247080 ACTTTTCAGGGTAATGGGGTAGG + Intergenic
1000007836 5:157203927-157203949 CTACCTCAGGGTTATGGGGAAGG + Intronic
1000379731 5:160618027-160618049 AGATTCCAGGGTATTGGGGATGG - Intronic
1000900608 5:166907523-166907545 CTATGTCAGGGTAAGGTGGAGGG + Intergenic
1001809420 5:174616175-174616197 GTATTTCAGGTTTCTGGGGAGGG + Intergenic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1002578175 5:180189959-180189981 TTATTTCAAGGAAATGGTGCTGG + Intronic
1003613412 6:7633324-7633346 TTGATTCATGGTAATGGAGAAGG - Intergenic
1006339734 6:33440306-33440328 GGATTCCAGGGAAATGGGGATGG - Intronic
1010443409 6:75925445-75925467 CAATTTCAGGGAAATGGAGAAGG + Intronic
1011023430 6:82839662-82839684 TAATTTCAGTGAAATGGGTAGGG + Intergenic
1011571522 6:88741766-88741788 TTATATGTGGGTAATGGGTAGGG + Intronic
1014646325 6:123977436-123977458 TTAGTTCAGGCTTATGAGGAAGG + Intronic
1016330651 6:142948706-142948728 TTGTTTCAGAGTCATGAGGATGG + Intergenic
1017737234 6:157376289-157376311 GTCTCTCAGGGAAATGGGGATGG - Intergenic
1018074907 6:160203276-160203298 TTATCGCAGGGATATGGGGAGGG + Intronic
1019232645 6:170581223-170581245 TTACTTCAGAGTAATGGAGGTGG - Intronic
1020804426 7:12770845-12770867 AGATTACAGGTTAATGGGGATGG - Intergenic
1021180657 7:17501485-17501507 TTATTTCTGGGAAATGGCCATGG - Intergenic
1021449868 7:20774990-20775012 TTATTGCAGGGAGGTGGGGAGGG - Intronic
1022003368 7:26246050-26246072 CTCTTTAAGGGTAATGCGGATGG - Intergenic
1022971135 7:35518401-35518423 TCATTTCAGGATCATGGAGAAGG + Intergenic
1024954321 7:54900511-54900533 CTATTTCAGGGGTGTGGGGATGG + Intergenic
1027897035 7:84058163-84058185 TTATTTCCCAGTATTGGGGAAGG + Intronic
1028641030 7:93042252-93042274 TTATTCCAGGGGAGTGGGAATGG + Intergenic
1029803894 7:102976650-102976672 CTCTTTAAGGGTAATGTGGACGG - Intronic
1031263446 7:119551902-119551924 TTAAATCAGGGTAATTGGGATGG - Intergenic
1031468504 7:122143353-122143375 TGATTTCAGGGGAATGGGGGTGG - Intronic
1032007561 7:128315232-128315254 TTATTTCTGTGTTATGGGAAGGG - Intronic
1033495730 7:141893162-141893184 TTATTTCAGGGTAGAAGGGCAGG - Intergenic
1038157981 8:25008935-25008957 TAATTTCAACGTTATGGGGAGGG + Intergenic
1038384749 8:27132524-27132546 TGTTTGCAGGGGAATGGGGAGGG - Intergenic
1038828033 8:31028279-31028301 TTAAATCAGTGTAATGGAGAAGG - Intronic
1039674358 8:39643981-39644003 TTATTACAGGATAATAGGAAAGG + Intronic
1040139630 8:43895185-43895207 TTATTTTACAGTAATTGGGAGGG - Intergenic
1041538116 8:58951355-58951377 TTATTTCAGGACACTGGGGGAGG + Intronic
1042158145 8:65866265-65866287 CTCTTTAAGGGTAATGCGGACGG - Intergenic
1043135417 8:76517798-76517820 TTATTTCTAGGTAATGGGTAGGG - Intergenic
1043912491 8:85879036-85879058 TTATTTGAAGGGAATTGGGAAGG - Intergenic
1044885761 8:96775255-96775277 TTATTTCAGGATAATAAAGAAGG - Intronic
1046424800 8:114032676-114032698 TTATTTGGGGGGAATGGGGATGG - Intergenic
1047751770 8:127886774-127886796 TCATCTCAGGATCATGGGGACGG + Intergenic
1048010747 8:130453738-130453760 CCATTTCAGGGGAATGAGGAAGG + Intergenic
1050629170 9:7540725-7540747 TAATGTTAGGGTAATGGAGATGG + Intergenic
1050697860 9:8299032-8299054 ATATTTCTGGGCAAAGGGGAGGG - Intergenic
1052054311 9:23886178-23886200 TTATATCATCGTAATGGTGATGG - Intergenic
1055283189 9:74698259-74698281 TTTTTTCAGGATAACAGGGAGGG + Intergenic
1056436678 9:86581223-86581245 ATATTTCATGGTGGTGGGGATGG - Intergenic
1057920889 9:99095662-99095684 TTTTGTCTGTGTAATGGGGAGGG - Intergenic
1058186621 9:101863048-101863070 CAATTACAGAGTAATGGGGAAGG - Intergenic
1058894940 9:109391425-109391447 TTATCTCAGTGTAGGGGGGAAGG + Intronic
1059502111 9:114763964-114763986 TTATTCCAGTGGAATGGGGCTGG + Intergenic
1061908794 9:133712139-133712161 CTAATGCAGGGTGATGGGGAGGG - Intronic
1062194977 9:135267951-135267973 TTATTTCAGGGGGAGGGGGCGGG - Intergenic
1185866099 X:3625328-3625350 TTATTTCAGGGCGATGGAGCAGG - Intronic
1185992088 X:4902561-4902583 TTGTTTCAGGGACCTGGGGAAGG - Intergenic
1187063353 X:15809241-15809263 GGATTTCAGAGTAATGGAGAAGG + Exonic
1187245427 X:17549420-17549442 CTTTTTCATGGTAGTGGGGAGGG - Intronic
1189978686 X:46488022-46488044 TTATTTTATAGTAATTGGGAGGG + Intronic
1190103922 X:47544921-47544943 TTATTACAGATCAATGGGGAAGG + Intergenic
1190512641 X:51189790-51189812 TTGTTTCAGGGAAAATGGGAAGG + Intergenic
1191124922 X:56944462-56944484 TTATTTTACAGTAATTGGGAGGG - Intergenic
1194874658 X:99171822-99171844 TTATTCCAGAGACATGGGGAAGG - Intergenic
1195684927 X:107576928-107576950 TTATTTCTGGGTGCTGGGGTTGG - Intronic
1196205053 X:112929898-112929920 TTATTTCATGGTCATGGCAAGGG + Intergenic
1197290859 X:124655355-124655377 TTGTTTTGTGGTAATGGGGAGGG + Intronic
1199205798 X:145146751-145146773 TGAAATCAGGATAATGGGGAGGG + Intergenic
1199231797 X:145444766-145444788 TTATTTCTGGGTTATAGGGTGGG - Intergenic
1199804516 X:151284592-151284614 ATATTTCAGGGAAGGGGGGAAGG - Intergenic
1200418889 Y:2941824-2941846 TTCTTTCAGGGTTTTGGAGATGG + Intronic
1200797728 Y:7357001-7357023 TTATTTCAGGGTGATGGACCAGG + Intergenic