ID: 992426370

View in Genome Browser
Species Human (GRCh38)
Location 5:76662158-76662180
Sequence CCTCACAGGGAGAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 616
Summary {0: 1, 1: 0, 2: 5, 3: 64, 4: 546}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992426362_992426370 15 Left 992426362 5:76662120-76662142 CCTCCATTCACACAAGCACATTC 0: 1
1: 0
2: 0
3: 25
4: 313
Right 992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG 0: 1
1: 0
2: 5
3: 64
4: 546
992426361_992426370 25 Left 992426361 5:76662110-76662132 CCAAAGCAAACCTCCATTCACAC 0: 1
1: 0
2: 0
3: 17
4: 191
Right 992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG 0: 1
1: 0
2: 5
3: 64
4: 546
992426360_992426370 26 Left 992426360 5:76662109-76662131 CCCAAAGCAAACCTCCATTCACA 0: 1
1: 0
2: 0
3: 18
4: 269
Right 992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG 0: 1
1: 0
2: 5
3: 64
4: 546
992426363_992426370 12 Left 992426363 5:76662123-76662145 CCATTCACACAAGCACATTCTGG 0: 1
1: 0
2: 1
3: 10
4: 239
Right 992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG 0: 1
1: 0
2: 5
3: 64
4: 546

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992426370 Original CRISPR CCTCACAGGGAGAAGGAAGA GGG Intronic
900573188 1:3370000-3370022 TGTCACAGGGAGAAGAAAGAAGG + Intronic
900816258 1:4848660-4848682 CTTCACAGGGAGAGGGGAGATGG + Intergenic
901700784 1:11043934-11043956 ACACACAGGAAGGAGGAAGAAGG + Intronic
901721963 1:11206088-11206110 CCTCTGAATGAGAAGGAAGAGGG + Intronic
901869188 1:12127450-12127472 GCTGGCAGGGGGAAGGAAGAGGG - Intronic
902045931 1:13524321-13524343 CCTCACAGTGACAATGACGAAGG + Intergenic
902399651 1:16150963-16150985 ACTGAAAGGGAGAAGGGAGAGGG + Exonic
902598663 1:17526181-17526203 CCACACAGGGAGGAAGGAGAGGG - Intergenic
903360576 1:22774431-22774453 GCTGCCAGGAAGAAGGAAGAAGG + Intronic
903471829 1:23592723-23592745 CCTCACAGTGAGGAGGATGGAGG - Intronic
903957644 1:27036155-27036177 TCTGCCAGGGAGTAGGAAGAGGG - Intergenic
905276970 1:36824699-36824721 GCCCAGAGGGAGAAGGCAGAGGG + Intronic
905456602 1:38092427-38092449 CCTGTCAAGGAGAAGGAAGAAGG - Intergenic
905788858 1:40779475-40779497 CTGCACAGGGAAAAGGAAGAAGG + Intergenic
905872902 1:41415257-41415279 TCTCACAGGGAGAAGCAGGAAGG - Intergenic
907220755 1:52905340-52905362 CCTCAAAGGTGGAAGAAAGATGG + Intronic
910260974 1:85293627-85293649 CCTCACATGGAGGAGAAAGCAGG - Intergenic
910758233 1:90712714-90712736 CCACCCAGGGAGAATGAAGGAGG - Intronic
911499860 1:98672461-98672483 GCTCACAGGAAGAAAGAAGAGGG + Intronic
912269720 1:108196800-108196822 CTCCACAGGAAGAAAGAAGATGG + Intronic
912450300 1:109764131-109764153 CCTAAAAGGCAGAGGGAAGAGGG - Intronic
912513466 1:110203594-110203616 CCTCCCAGGAAGCAGGAAGCTGG - Intergenic
912629961 1:111238443-111238465 ACTCAAAAGGGGAAGGAAGATGG + Intronic
912649014 1:111421782-111421804 CCCCACAGGCAGAAGGAGCAGGG - Intronic
912681332 1:111730927-111730949 CTACACAGGGAGAAAGAAGCAGG + Intronic
914726562 1:150332622-150332644 CCTGAATGGGAGAAGTAAGAAGG + Intronic
915024316 1:152812851-152812873 GCCCAGAAGGAGAAGGAAGACGG - Exonic
915392800 1:155559693-155559715 TCTCAAAAGGACAAGGAAGAGGG - Intronic
915408904 1:155685271-155685293 TCTCAAAAGGACAAGGAAGAGGG - Intronic
915922903 1:159990510-159990532 CCTCATATGGGGAAGGGAGAGGG - Intergenic
916360151 1:163959141-163959163 CCTCCCTGTTAGAAGGAAGATGG + Intergenic
916535161 1:165697131-165697153 GGTCACAGAGATAAGGAAGAAGG - Intronic
918015349 1:180628328-180628350 CAACAGAGGGAGAAGGAAGAAGG - Intergenic
918338559 1:183547066-183547088 CATCACAGTGAGAAGCAATAAGG - Intronic
919294573 1:195679674-195679696 CCTTACAAGAGGAAGGAAGAAGG + Intergenic
920300023 1:204982901-204982923 CCTAACAGTGAGATGGAGGAAGG + Intronic
920530025 1:206695070-206695092 GCTCACAGAGAGGAGGAGGAAGG + Intronic
921350328 1:214228050-214228072 ACAGATAGGGAGAAGGAAGAAGG + Intergenic
923015262 1:230121479-230121501 CCTGGCAGGGACAAAGAAGAGGG - Intronic
923394227 1:233544666-233544688 CGGCACAGGGAGAAGGAACCAGG - Intergenic
923513411 1:234673302-234673324 TCACACAGGGAGAAGGATGTAGG + Intergenic
923717514 1:236437572-236437594 TGTGGCAGGGAGAAGGAAGAGGG + Intronic
924260978 1:242231230-242231252 CTCAACAGGGAGGAGGAAGAGGG - Intronic
924897187 1:248352823-248352845 CCTCACAAGGGGAAGACAGAAGG + Intergenic
1062843992 10:690452-690474 CCCCACAAGGAGAAGGACGGTGG - Intergenic
1062945543 10:1458576-1458598 CCCCAAGTGGAGAAGGAAGAAGG - Intronic
1063067412 10:2623750-2623772 CATGACAGGGAGAGGGAAGCAGG + Intergenic
1063457141 10:6191846-6191868 CGAGACAGGGAGAAGGAACAAGG - Intronic
1064229830 10:13520336-13520358 CACCACAGGGAGAAGGAATGGGG - Intronic
1064796740 10:19020531-19020553 CCTCACATGGTGGAGAAAGAGGG + Intergenic
1066226313 10:33386874-33386896 CCTGACAGGCAGAGGGAAGATGG + Intergenic
1066499300 10:35974483-35974505 TCTCACAGGGAGGAAGAGGAAGG - Intergenic
1067882749 10:50060870-50060892 CCTCACTAGGAGATGGAACAAGG - Intergenic
1069065984 10:63942310-63942332 ACTGAGAGGGAGAAGGAAAATGG - Intergenic
1070026548 10:72637499-72637521 TATGAAAGGGAGAAGGAAGACGG + Intergenic
1070068604 10:73063316-73063338 CCTCACATGGTGAAGGCTGAAGG + Intronic
1070711312 10:78685278-78685300 TCCAACAGGGAGAAGGTAGAGGG - Intergenic
1070791010 10:79189360-79189382 CATCAGAGGCAGAAGGAAGCTGG - Intronic
1070809661 10:79291217-79291239 CCCCACTGGAAGGAGGAAGAGGG - Intronic
1070928563 10:80243380-80243402 CTTCTCAGGGAAAAGGGAGATGG + Intergenic
1071175638 10:82923783-82923805 ACACACAGGTAGAAGGAGGAGGG - Intronic
1071406354 10:85337032-85337054 CCTCACAGAGGGAGGGAAGAAGG + Intergenic
1071847459 10:89535468-89535490 CGTGTCAGGGAGAGGGAAGAGGG + Exonic
1072525669 10:96269510-96269532 CATGGCAGTGAGAAGGAAGAGGG - Intronic
1072881317 10:99232577-99232599 GCCCTCAGGGAGTAGGAAGAGGG - Intronic
1073190814 10:101649641-101649663 CCTGACAAGGAGAAAGAAGCTGG - Intronic
1073417055 10:103392929-103392951 CCTCCATGGGAGAAGGGAGAAGG + Intronic
1073733201 10:106315641-106315663 CTTCCCAGGGAGAGGGAGGACGG + Intergenic
1074269907 10:111944141-111944163 TCTCACAGGGAGGAAGAAAAGGG + Intergenic
1074543276 10:114383952-114383974 CGTCACAGGAAGAATGAAGCAGG + Intronic
1075004900 10:118823081-118823103 CCTAACAAAGAGAAGGAACAGGG - Intergenic
1075714032 10:124545581-124545603 GCTCCCAGGTAGCAGGAAGAAGG + Intronic
1075904061 10:126065292-126065314 CCTCAGAGGAAGAAGAAGGAGGG + Intronic
1076108990 10:127846655-127846677 CATCACTGGGAGAAGGGAGGTGG - Intergenic
1076167448 10:128293906-128293928 CCTCACAGGGAGGCGGAAGTGGG - Intergenic
1076177221 10:128377343-128377365 CCTCACAGAGGTAAGGAAGGGGG + Intergenic
1076468693 10:130703684-130703706 CCTGAGAGGCAGTAGGAAGAAGG + Intergenic
1077524182 11:3054266-3054288 CCTCCCAGTAAGGAGGAAGATGG - Intronic
1077559802 11:3252645-3252667 TCTCACAGGGAGGAAGAAAAAGG - Intergenic
1077565695 11:3298448-3298470 TCTCACAGGGAGGAAGAAAAAGG - Intergenic
1078757769 11:14227505-14227527 CCTGACAGAGAGCAGGAGGAGGG - Intronic
1079990646 11:27242907-27242929 CCTCACTGGGAAAATGAAAATGG + Intergenic
1081904347 11:46657780-46657802 CCTAAGAGGGAGCAGAAAGAAGG - Intronic
1082835733 11:57649075-57649097 GATCACAGGGAGAAGCAAGTTGG + Exonic
1083201724 11:61124865-61124887 CCTCCCAGGAAGAAAGGAGAGGG + Intronic
1083649404 11:64192668-64192690 CCTCACAGGAAGAAGGTGGGCGG - Intronic
1083806196 11:65075582-65075604 CCACATGGGGTGAAGGAAGAAGG + Intronic
1084805253 11:71574155-71574177 CCTCACAGGGAATAGGTAGTGGG + Intergenic
1085450098 11:76626685-76626707 CCCCACAGGGAGAGGGATTAAGG + Intergenic
1085625116 11:78065908-78065930 CCTCAACGGGAGAGGGAAGAAGG - Intronic
1085832529 11:79916735-79916757 CCTCTGAGGGAGAGGGAACACGG - Intergenic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1087102722 11:94380769-94380791 CCTCACTGGGGGCAGGAAGTGGG + Exonic
1087806564 11:102561899-102561921 AATCACAAGGAGCAGGAAGAGGG - Intergenic
1088156822 11:106815736-106815758 CCTCACAAGAGGAAGGCAGAGGG + Intronic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088567734 11:111190774-111190796 CAACACAGGGAGAACCAAGAAGG + Intergenic
1088812750 11:113402517-113402539 GCTAGCAGGGAGTAGGAAGATGG - Intergenic
1088907267 11:114164258-114164280 CGAGAGAGGGAGAAGGAAGAAGG - Intronic
1089210039 11:116793794-116793816 CCTCCCAGGGAACAGGAAGGAGG + Intergenic
1089442439 11:118528714-118528736 CCTCTCAGGCAGCAGGCAGATGG - Exonic
1089706148 11:120279449-120279471 CCACACAGGGAGAAGGGTGGTGG - Intronic
1090466879 11:126942844-126942866 TCTCAGAGAGAGAAGGAAAAGGG - Intronic
1090596418 11:128325332-128325354 CTTCTGAGGGAGAAGGTAGATGG + Intergenic
1090873761 11:130770684-130770706 CCTCACATGGATAAGGCACACGG + Intergenic
1091296675 11:134478566-134478588 ATACACAGGCAGAAGGAAGAAGG - Intergenic
1092818512 12:12331703-12331725 TCTGACAGGGAGGAGGAGGAGGG + Intronic
1094706156 12:32916110-32916132 ACTCACAGGGGGAAGGAACTTGG + Intergenic
1095898568 12:47305179-47305201 CCTCTAAGGGAGAATGGAGATGG + Intergenic
1096546796 12:52345657-52345679 TCTCACAGGCAGGAGGAAGAGGG + Intergenic
1096848933 12:54423126-54423148 TCTCACAGAGGGAAGGAAGGTGG + Intergenic
1097689856 12:62724526-62724548 CCTCAGAGGGAGAGGGTAGGTGG - Intronic
1099618911 12:84976007-84976029 CTTCACTGGCAGAGGGAAGAGGG - Intergenic
1100123696 12:91397740-91397762 CATCCCATGGAGAAGGCAGAAGG + Intergenic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1101730640 12:107424396-107424418 TCTCCAAGGGAGAAGGAATATGG - Intronic
1101998969 12:109544910-109544932 CTTCACAGGCAGGAGGAAGTGGG - Intergenic
1102528428 12:113528653-113528675 CCTGACAGGGGGAAGAGAGAGGG - Intergenic
1103021176 12:117535556-117535578 GCTCAAAGGGAGAAGAAAGGAGG - Intronic
1103074056 12:117968288-117968310 CCTCCCAGAGAGAAAAAAGAGGG + Intronic
1103648919 12:122417892-122417914 CATCCTAGGGAGAAGGAAGGAGG - Intronic
1103688219 12:122749877-122749899 GCTCAAAGGGAGAAGGATTAGGG - Intergenic
1104694328 12:130852085-130852107 CCACGCAGGGAGAACGGAGAAGG + Intergenic
1105577531 13:21668001-21668023 CCACACATGGAGTAGGCAGAGGG + Intergenic
1106769543 13:32948555-32948577 CCTCCCATGGGGAAGCAAGAAGG - Intergenic
1106944862 13:34815907-34815929 CTTCTTAGGGAAAAGGAAGATGG - Intergenic
1107196540 13:37659311-37659333 CATCACAGGGGGAAAGAGGAAGG - Intronic
1107566920 13:41614371-41614393 CCGCAGAGGAAAAAGGAAGACGG + Intronic
1108379486 13:49842422-49842444 CCTCACATGGAGAAGGCAGAAGG - Intergenic
1108478323 13:50843040-50843062 CCCCAGTGGGAGAAGGAAGGGGG - Intronic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1110252090 13:73391750-73391772 TCACCCAGGGAGAAGGATGAAGG + Intergenic
1110359276 13:74607116-74607138 CCTGACAAGGACCAGGAAGAAGG - Intergenic
1110408503 13:75177583-75177605 CCTCACATTGAGGGGGAAGAGGG + Intergenic
1111225138 13:85260934-85260956 TCTTAAAGGGAGAAGGAAGAGGG + Intergenic
1111233964 13:85383741-85383763 TCACAGAGGGAGAAGGTAGAGGG - Intergenic
1111361317 13:87181731-87181753 CTTCACAGGGGGTAGGAAGTGGG - Intergenic
1111831736 13:93338858-93338880 CCACTGAGGGAGCAGGAAGATGG - Intronic
1112939799 13:104847787-104847809 TTCCACAGGGAGAAGGAAAAAGG + Intergenic
1113352400 13:109542315-109542337 CCTCGCAGGGAGAAGGCAAGAGG + Intergenic
1113356939 13:109589888-109589910 ACTCACTGGAAGAAGGAAAAGGG + Intergenic
1113667319 13:112149732-112149754 CCTCACAGGGGGAAGGTGGTGGG - Intergenic
1114265910 14:21072419-21072441 CCACTGTGGGAGAAGGAAGAGGG + Intronic
1115832507 14:37357987-37358009 CCTCTCAGGGGGCAGGAAGCTGG - Intronic
1117215088 14:53543132-53543154 GCTCACACTGAGCAGGAAGATGG - Intergenic
1117365250 14:55020970-55020992 CTTCACAGTGAGAAGGCTGACGG + Intronic
1117642552 14:57815590-57815612 CATCAGAGGTAGAAGTAAGAAGG - Intronic
1117838220 14:59829681-59829703 TCACACAGGGAGCAGGCAGAGGG + Intronic
1118176227 14:63442584-63442606 ACACAGAGAGAGAAGGAAGAGGG + Intronic
1118848282 14:69564851-69564873 CCACACAGGAATAAGGAAGAGGG - Intergenic
1118866830 14:69711021-69711043 TCCCACAGGGAGAGGGAGGAAGG - Exonic
1119321121 14:73731080-73731102 CCTAGCAGGGAGAAGTAGGAGGG - Intronic
1119323209 14:73743635-73743657 CCTCACAGTGAGGAAGAGGAAGG + Intronic
1120439777 14:84521252-84521274 CTGCACAGGAATAAGGAAGAGGG + Intergenic
1120624447 14:86807309-86807331 CCTCACATGTGGAAGGCAGAGGG + Intergenic
1121027181 14:90625225-90625247 CGTGACCGGGAGAAGGCAGATGG + Intronic
1121161281 14:91743712-91743734 CCTCCCATGCAGAAGGCAGAAGG - Intronic
1121344962 14:93128856-93128878 CCTCACAGTAAGAAGGATGGTGG - Intergenic
1121715212 14:96068924-96068946 CCACTGAGGGAGAAGGAAAAAGG + Intronic
1122225549 14:100275715-100275737 GCTCACAGGCAGAAGGGAGAGGG - Intronic
1122878054 14:104677860-104677882 CCTCCCAAGGAGGAGGCAGATGG + Intergenic
1122925419 14:104897361-104897383 CCTAGCAGGGAGAAGGAACTGGG - Intergenic
1125599046 15:40905799-40905821 CCACATGGGGAGAAGGAAGCAGG - Intergenic
1125611812 15:40976523-40976545 CCTCAGGGGAAGAAGGAAGGGGG - Intergenic
1127173432 15:56328077-56328099 CCTTACAAGCAGAAGGAAGCGGG - Intronic
1127437365 15:58971366-58971388 TCTTTCAGGGAGAAGGAAAAGGG - Intronic
1127845332 15:62865839-62865861 GCTCTCAGGGTGAAGGAAGTGGG + Intergenic
1127952538 15:63823483-63823505 CCTAACTGGTAGAAGGAAGAAGG + Intronic
1128704827 15:69831376-69831398 TCTTCCAGGGAGAAGGCAGAGGG - Intergenic
1129032521 15:72629303-72629325 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129042730 15:72704030-72704052 CCTTAAAGGGAGAAAGAAGGGGG + Intronic
1129201403 15:74003577-74003599 TCTGAAAGTGAGAAGGAAGAGGG - Intronic
1129407291 15:75328051-75328073 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129470477 15:75750914-75750936 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129734526 15:77952224-77952246 CCTCACAGGCAGAAAGAGGGAGG + Intergenic
1129841064 15:78743767-78743789 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129921571 15:79323629-79323651 CCTCAGAGGGTGAAGGAGAAGGG - Intronic
1130912467 15:88280462-88280484 CTTCAGTGGGAGAAGGAAAAGGG + Intergenic
1130921146 15:88345686-88345708 CCTCACATGGTAAAGGAGGAAGG + Intergenic
1132453974 16:12503-12525 CATCACAGGGAAGAGCAAGAGGG - Intergenic
1132746006 16:1436588-1436610 CCACACAGGGAGAGGGAGGAGGG + Intronic
1133276515 16:4641297-4641319 CCACACATGGAGAAGAAACACGG - Intronic
1133441144 16:5821823-5821845 CCTCACATGGTGAAAGGAGAAGG + Intergenic
1133593511 16:7268421-7268443 GCTCTCTGGGAGAAGGAAGCAGG + Intronic
1134463106 16:14446930-14446952 CCTCTCAGAGGGAAGGAAAAAGG - Exonic
1134831168 16:17324260-17324282 GCTCACTGGGAGCAGCAAGAAGG + Intronic
1135793647 16:25421485-25421507 CTGGGCAGGGAGAAGGAAGAGGG + Intergenic
1136381510 16:29898189-29898211 CAGCCCAGGGAGAAGGGAGAGGG - Intronic
1136403245 16:30029745-30029767 CCACAAATGGGGAAGGAAGAAGG - Intronic
1136544999 16:30949628-30949650 CGTCAAAGGGGGAAGGAACAAGG + Intronic
1137758672 16:50922844-50922866 ACTCAGAGTGGGAAGGAAGAGGG + Intergenic
1137773111 16:51033979-51034001 CCAAACAGGGAGAAGGGTGAGGG - Intergenic
1137883111 16:52073281-52073303 CTTCTCAGGGAGCAGGAGGAGGG + Intronic
1138101314 16:54254346-54254368 AGTCACAGGGAGAAGGAACAGGG + Intronic
1138204741 16:55116227-55116249 CAACACAGTGAGAAGGAAGCAGG + Intergenic
1138374089 16:56550716-56550738 CCCCACAGGAAGCAGGAAGATGG - Intergenic
1139336441 16:66235032-66235054 CCTCACATGGTGAAGGGAGAAGG - Intergenic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139517027 16:67458242-67458264 CCTCAGAGAGAGCAGGAAGCTGG - Intronic
1140659678 16:77176089-77176111 CATCTCAGAGAGAGGGAAGAGGG - Intergenic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1141376596 16:83536447-83536469 CATCACAGGGAGAGAGAAAAGGG + Intronic
1141635137 16:85310577-85310599 GCTCAAAGGGAGAAGCAACAAGG - Intergenic
1141832483 16:86517447-86517469 CTTCCCAGGGATAAGGAAGATGG + Intergenic
1142108573 16:88319165-88319187 CCTCACAGACAGATGGAAGAGGG + Intergenic
1142237360 16:88928541-88928563 CCTCACTGGGTGCTGGAAGAGGG - Intronic
1142479204 17:207775-207797 CCCCAAAGGGAGAAGCATGAAGG + Intergenic
1142623356 17:1178754-1178776 GCTCTCAGGGATTAGGAAGAGGG - Intronic
1142857300 17:2738400-2738422 TCTTACAGGGGGAAGGAAAATGG - Intergenic
1143045093 17:4071784-4071806 CCTCACAGGAAGATGGAAACAGG + Intronic
1143388884 17:6548476-6548498 CCTCACGGGGGGCAGGAAGTAGG + Intronic
1143814031 17:9496760-9496782 CATCAGAGGGAGTATGAAGAAGG + Intronic
1143935473 17:10479866-10479888 CCTCACTGGAAGGAGGAAGATGG + Intergenic
1144299761 17:13912443-13912465 CCCCACACCAAGAAGGAAGAAGG + Intergenic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1145962969 17:28897970-28897992 TCTCACAGTGAGTAGGAGGAGGG - Exonic
1146427453 17:32755451-32755473 CCTCACAGATAAAAGGAAGAAGG + Intronic
1146673596 17:34758222-34758244 CCTCCCAGGGATGAGGAGGAAGG - Intergenic
1146801167 17:35824129-35824151 GGTCACAGGGAGGAGGTAGAGGG + Exonic
1146911797 17:36653163-36653185 CCTCAGTGGGAGGAAGAAGAGGG - Intergenic
1147952792 17:44116318-44116340 CCTCAGAGGGGCAAGCAAGAGGG + Intronic
1148330945 17:46813649-46813671 CCTTCCAGGGAAAAGGAAGTGGG - Intronic
1149335710 17:55633639-55633661 GTTCCCAGGGAGATGGAAGATGG + Intergenic
1149413961 17:56438900-56438922 CATCAAAGGGAGAAGGAGAAGGG + Intronic
1149529077 17:57380503-57380525 CCTAACAGGGAGAGTGAAGCGGG + Intronic
1150204020 17:63387209-63387231 CCCCACAGGGAGAAAAAAAAAGG + Intronic
1150224046 17:63513360-63513382 CCTGGCAGGGAAAAGGCAGAGGG - Intronic
1150361020 17:64534266-64534288 CCTCACAAGGAGTAGGAAAATGG - Intronic
1151115838 17:71733916-71733938 CTACACAGGGAGGAGGAGGAGGG - Intergenic
1151305354 17:73259694-73259716 CCATACAGGGAGAAGGGAAATGG - Intronic
1152278396 17:79371412-79371434 CCCCACAGGGAGCAGGAAAGGGG - Intronic
1152498064 17:80688555-80688577 GCTCAAAGGGAGAAAGAAGAAGG + Intronic
1152512822 17:80801970-80801992 CCCCACGGGCAGAGGGAAGACGG + Intronic
1152903979 17:82960592-82960614 CCTCACAGTGACACGGGAGAGGG + Intronic
1153722744 18:7923362-7923384 CTCCACAGGGAGATGGAAGGCGG + Intronic
1154384853 18:13884025-13884047 ACTAACAGGGAGAAAGAGGAGGG + Exonic
1155524423 18:26702068-26702090 ACTTACATTGAGAAGGAAGAGGG + Intergenic
1156086931 18:33416789-33416811 CCACATAGGGAGAAGTAACAAGG + Intronic
1156269050 18:35514332-35514354 CATCAAAGGGAGATGGAGGATGG - Intergenic
1157890088 18:51407234-51407256 CCCAACAGGGAGAAGGAATATGG - Intergenic
1158201557 18:54947313-54947335 GCTCCCAGGGAGGAGGCAGAGGG + Intronic
1158241202 18:55380219-55380241 CCTCACATGGAGAAGAGAGAAGG + Intronic
1158453591 18:57587600-57587622 CCTGAGAGGGAAAAAGAAGAGGG - Intergenic
1158962518 18:62598125-62598147 CCTCAAAAGGAAAAGGAAGCGGG - Intergenic
1159913695 18:74170056-74170078 CCACACAGTGAGAAGCAAGGTGG - Intergenic
1160567414 18:79795584-79795606 GATCACAGGGAGAAGGAAATGGG + Intergenic
1161330985 19:3687770-3687792 CCCGGCAGGGAGAAGGGAGAAGG - Intronic
1161819689 19:6522266-6522288 CCTCAGAGGCAGAAGAAGGAGGG + Intergenic
1162454875 19:10777336-10777358 GCTCAAAGGGAAAAGAAAGAAGG - Intronic
1163302806 19:16458291-16458313 CCCCACAGTGAGCAGAAAGATGG + Intronic
1163401112 19:17093416-17093438 CTCCACAGGGCCAAGGAAGATGG - Intronic
1164684476 19:30157839-30157861 CCTCACGTGGTGAAGGCAGAAGG - Intergenic
1164861661 19:31566537-31566559 CCTGACAGGGGGAAAGAGGAGGG + Intergenic
1165489289 19:36114110-36114132 CCTCACTGGGCGAAGGGAGGAGG - Intronic
1167726514 19:51216901-51216923 CATCCCAGGAAGAAGGAAAAGGG + Intergenic
1168246707 19:55116243-55116265 CCCCAGAAGGAGAAGGAAAAGGG + Intronic
1168675897 19:58277920-58277942 ACCCACAGGGAGAAGCAATAGGG + Intronic
925080859 2:1064833-1064855 CCTCACAGGTTAAAGGAACAAGG + Intronic
925084575 2:1097910-1097932 CCTCACAAGCAGAATGCAGACGG + Intronic
925522010 2:4757300-4757322 CGTCAGAGGAAGAGGGAAGAAGG - Intergenic
925707483 2:6700811-6700833 CCTCACAGTTACAATGAAGAAGG + Intergenic
926191710 2:10733154-10733176 CCTATCAGGGGGAAGGAAAATGG + Intronic
926647652 2:15306989-15307011 CCTCACAGTGAGAAGGGACCAGG + Intronic
926695982 2:15770490-15770512 CCTAACAGGGAGGAGGGAGCTGG - Intergenic
926761045 2:16279400-16279422 TCTGACAGGGATAAGGGAGAAGG + Intergenic
926811557 2:16759405-16759427 CCTCATATGGACAAGGCAGATGG - Intergenic
927177366 2:20420056-20420078 GCTCACAGGAACAGGGAAGATGG + Intergenic
927186358 2:20485294-20485316 CAGCCCAGGTAGAAGGAAGATGG - Intergenic
927377784 2:22438255-22438277 TCTCACAAGGAGATAGAAGAGGG - Intergenic
927454955 2:23241393-23241415 CCTTTCAGGGAGAAAGGAGAGGG - Intergenic
927553673 2:24018360-24018382 CCGCACAGGGAGGTGGCAGAAGG - Intronic
927666453 2:25036233-25036255 CCTCCCAGAGGGAGGGAAGAGGG - Intergenic
928019304 2:27689446-27689468 CAGCAAAGGGAGAAGGAACATGG + Intronic
930058938 2:47272679-47272701 CCTCTCTGGGAGAAGGCAGGTGG + Intergenic
931018050 2:58008975-58008997 ACTCACAGGGAGAAGGTAGAAGG + Intronic
931027861 2:58134240-58134262 TCTTAAAGGGAGAAGGGAGAGGG - Intronic
931140624 2:59453660-59453682 CCAGACCGGGAGAAGGAGGAAGG - Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932398534 2:71464412-71464434 CCTGAAAGGGAGATGAAAGAGGG + Intronic
932515840 2:72348158-72348180 GCTCACAGGTAGAAGGAGTAAGG + Intronic
932568175 2:72922498-72922520 CATCACAGGGAGATGGGTGAGGG - Intronic
932581683 2:72996240-72996262 GCTCACAGGGAGGAGAAAGGAGG + Intronic
933796167 2:85921513-85921535 CCTCTAAGGGAGAAGGAAAGTGG + Intergenic
935095631 2:99941708-99941730 CCTGATAGGAAGGAGGAAGAAGG - Intronic
935277807 2:101490885-101490907 CCTCACATGTAGAAGGCAGAAGG - Intergenic
935695414 2:105766909-105766931 CTGCACAGGCAGCAGGAAGACGG - Intronic
936261711 2:110965764-110965786 CCTGGAAGGGGGAAGGAAGAAGG + Intronic
936715649 2:115184065-115184087 CCAGACAGGGAGAGGGAATAGGG + Intronic
937658784 2:124407569-124407591 CTTCACAGGGGAAAGGGAGATGG + Intronic
937796175 2:126023729-126023751 CATCACAGAGAGAAATAAGATGG + Intergenic
937799811 2:126070444-126070466 CTTCACATTGAGAAGGAGGAAGG - Intergenic
938969559 2:136419837-136419859 CCAGGCAGGGAGAAGGGAGACGG - Intergenic
939566278 2:143789909-143789931 CTTCACAGGGGAAAGGGAGATGG + Intergenic
939577771 2:143916748-143916770 CCTCAAGGGCAGAAGGCAGAAGG + Intergenic
939698499 2:145358746-145358768 TCTAACAGGGAGAAGTAGGAGGG + Intergenic
939979018 2:148756728-148756750 CCTCACAGAGGGAAGAGAGAAGG - Intronic
940111965 2:150164840-150164862 ACTCAGAGGGAGAAGGAGCAAGG - Intergenic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
940412854 2:153386588-153386610 TCACCCAGGGAGAAGCAAGAAGG + Intergenic
941020066 2:160398239-160398261 CCTCAAAGGAATATGGAAGATGG - Intronic
941076116 2:161008312-161008334 CCTCCCAGTTAGAATGAAGAGGG + Intergenic
941576109 2:167232388-167232410 ACTCAAAGAGAGAAGGAAAAAGG - Intronic
941588386 2:167388198-167388220 CCTTAAAGGGAGAATGAATATGG + Intergenic
941853401 2:170206722-170206744 CCACCCAGGGAAAAGGGAGAGGG - Intronic
942188905 2:173451646-173451668 TCTCACAGTGAGAAGAAATATGG + Intergenic
942655578 2:178211160-178211182 CCTCACGAGGCTAAGGAAGAAGG + Intronic
942937431 2:181575115-181575137 CATCAGTGGGAGAAGGGAGAAGG - Intronic
943197419 2:184771969-184771991 TCTCAAAGGGAGAGGGAATAGGG + Intronic
943712579 2:191113572-191113594 CTTCACAGGGAGATGTAAGAAGG + Intronic
944699945 2:202238106-202238128 CCTCCCAGGGAGGTGGAAGCGGG + Intronic
944864630 2:203848356-203848378 CCTTACACGGATGAGGAAGAGGG + Intergenic
945422275 2:209653315-209653337 CCATACAGGGAGGATGAAGAGGG + Exonic
946020671 2:216637771-216637793 CCTGTCAGGCAGAGGGAAGAGGG + Intronic
946064169 2:216972184-216972206 AAACACAGGGAAAAGGAAGATGG + Intergenic
946484157 2:220084829-220084851 ACTCTTAGGGACAAGGAAGATGG - Intergenic
946980160 2:225204417-225204439 CATTAAAGGGAGAAGGAAGGAGG - Intergenic
947295242 2:228623803-228623825 CAGCCCAGGGAGAAGCAAGAGGG - Intergenic
947738656 2:232474463-232474485 CTCCACAGGGAGAAGGAAGCTGG + Intergenic
947857164 2:233331831-233331853 CCTCGAAGGGAGAAAGAGGAAGG - Intronic
947862567 2:233371731-233371753 CCACACAGGAAGAATGAAGTTGG - Intronic
948708292 2:239809465-239809487 CCACACAGGGAGGAGGGAGGAGG - Intergenic
1169021712 20:2335465-2335487 CCAGACAGGGAGCAGGAACACGG - Intronic
1169150806 20:3287929-3287951 CCTCACAGAAAAAAGGCAGAGGG + Intronic
1169191738 20:3662433-3662455 ACACACAGGGAGATGGATGAGGG - Intronic
1169263998 20:4156661-4156683 CCTCACTGGGTGAATGAGGAAGG + Intronic
1169268163 20:4180341-4180363 GGCCACAGGGTGAAGGAAGATGG - Intronic
1169309799 20:4526044-4526066 TCTCACATGGAGAAGAAACATGG - Intergenic
1169894736 20:10490792-10490814 GTTCACAGGGAGAAGGAGAATGG - Intronic
1170042200 20:12050743-12050765 CCTCAGAGGGTGGAGTAAGAGGG - Intergenic
1170043369 20:12061263-12061285 CCTGACAGTGAGAAGAGAGACGG + Intergenic
1170099287 20:12680977-12680999 CCTCAGAGACAGAATGAAGATGG + Intergenic
1170704187 20:18729869-18729891 ACTCAGAGAGAGAAGGAAGAAGG - Intronic
1170786353 20:19470974-19470996 CCTCAGAGGGAGACGGCACAAGG + Intronic
1170789615 20:19496984-19497006 ACTCACAAGGAGAAGGCAGAAGG - Intronic
1170936233 20:20812217-20812239 GCTGACAAAGAGAAGGAAGATGG - Intergenic
1171201804 20:23247789-23247811 CCTCACAGGGAGGATGAAAGGGG + Intergenic
1171304297 20:24092004-24092026 ACTCACAGGGAGAAAGAATTTGG + Intergenic
1172217605 20:33247433-33247455 CCTTATAGGGTTAAGGAAGAGGG - Intergenic
1172290161 20:33770303-33770325 CCACCCAGGGAGAGGGAAGCAGG - Intronic
1172607918 20:36227546-36227568 CCTCAGAGGGACAAGGAAGCAGG - Intronic
1172674506 20:36658556-36658578 CTTCAAAGGGAAAAGGAAGATGG + Intronic
1172782932 20:37447854-37447876 GAGCACAGGGAGAGGGAAGATGG - Intergenic
1172829717 20:37823323-37823345 CCTGACTGGCTGAAGGAAGAAGG + Intronic
1173589234 20:44211056-44211078 CCTAACAGAGAGGAGGAAGCAGG - Intergenic
1173958788 20:47055388-47055410 CCACACTGGGTGAAGGCAGATGG + Intronic
1174488687 20:50877036-50877058 CATCACAGAGAGAAGGACCATGG - Exonic
1174813776 20:53669415-53669437 CCACACAGAGACAAGGAAGGGGG - Intergenic
1175226749 20:57449107-57449129 CCTCATTGGGAGAATGAAGTGGG - Intergenic
1175287458 20:57846496-57846518 GGGCACAGGGAGAAGGAAGCAGG - Intergenic
1175743577 20:61437393-61437415 CGTCACAGGGAGACAGAAGATGG - Intronic
1175825620 20:61934983-61935005 CCGCAAAGGAAGATGGAAGACGG - Intronic
1176172845 20:63703910-63703932 CCCCACAAGGAGGGGGAAGAGGG + Intronic
1177486043 21:21757573-21757595 CCTCACATGGCAAAGGCAGAAGG + Intergenic
1178959994 21:37056777-37056799 TCACACAGCAAGAAGGAAGATGG + Intergenic
1178970133 21:37167090-37167112 CCTCAGAAAGAGAAGGAAAAAGG + Intronic
1179438818 21:41379499-41379521 CCTCTCAAGGAGTGGGAAGAAGG - Intronic
1179514448 21:41897189-41897211 CCAGACAGGGGGAAGGAGGAGGG + Intronic
1180588565 22:16915584-16915606 CCTCACAGGGAGAATGATGTGGG + Intergenic
1181324150 22:22032108-22032130 CAGCCCAGGGAGAAGAAAGAGGG + Intergenic
1181437929 22:22921192-22921214 CCCCAGAGGGAGAGGGGAGAGGG - Intergenic
1181764719 22:25083240-25083262 CCACACACGCAGAGGGAAGATGG - Intronic
1182055003 22:27345644-27345666 CCTCAACTGGAGAAGGAAGAGGG - Intergenic
1182824516 22:33253354-33253376 TCTCAGAGGGTGAAAGAAGATGG + Intronic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1184618139 22:45652163-45652185 GATCACAGGAAGAAGGAAAAAGG - Intergenic
1184943134 22:47783100-47783122 CTCCACAGGGAGGAGGGAGATGG + Intergenic
1185180856 22:49362035-49362057 AATCACAGAGAGAGGGAAGAGGG + Intergenic
1185315785 22:50178525-50178547 CCTCAAAGGGGGAAGGGAGGAGG + Intronic
949303273 3:2609305-2609327 CCTCACATGGTGAAGGCAGAAGG - Intronic
949562949 3:5219577-5219599 CCTTGCAGAAAGAAGGAAGAGGG - Exonic
949614669 3:5739740-5739762 ACTCATAGGAACAAGGAAGAGGG - Intergenic
949919432 3:8989488-8989510 GTTCAAAAGGAGAAGGAAGAAGG - Intronic
950060661 3:10069485-10069507 CATCAGAGGGAGACGGGAGAGGG - Intronic
950122750 3:10492678-10492700 CCCCAGAGGGAGAAGGAAGCGGG - Intronic
950420767 3:12898085-12898107 CCTCACAGTGAGAAGGGACCAGG + Exonic
950464959 3:13148267-13148289 CCTCACAGAGGGAGGGAGGAGGG + Intergenic
950715062 3:14842135-14842157 CCTCAGAGGGAAATGGTAGAAGG - Intronic
950866206 3:16191120-16191142 CCTCATAGTGAGAGAGAAGATGG - Intronic
951698637 3:25471933-25471955 CCTGACAATGAGAAGGTAGAGGG - Intronic
951781207 3:26364685-26364707 CAAAACAGGGAGAAGGAAAAAGG - Intergenic
951800193 3:26587207-26587229 CCTCACAGGCACAAGGGAGAAGG - Intergenic
952343751 3:32466061-32466083 CCTCAAAGGGTGAAGGACCAAGG + Intronic
952465428 3:33580103-33580125 CCACAGAGGGAAAAGAAAGAGGG + Intronic
952707150 3:36391032-36391054 CCTGCCAGAGAGAGGGAAGATGG - Intronic
952759304 3:36899798-36899820 TGACACAGAGAGAAGGAAGAAGG + Intronic
953335351 3:42089631-42089653 TGTCACTTGGAGAAGGAAGAGGG - Intronic
953742727 3:45551469-45551491 TCTCACAGGAAGAAAGACGAGGG - Intergenic
954445711 3:50545832-50545854 CCTCAAAGGGGGCAGGAGGAGGG - Intergenic
954581258 3:51704086-51704108 CCCCAGAGGAAGGAGGAAGAGGG - Exonic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954806274 3:53222736-53222758 CCTCTTTGGGAGGAGGAAGAGGG - Intergenic
955611506 3:60762408-60762430 CATCACAGGCAGAAGAAAGAGGG - Intronic
955943517 3:64169189-64169211 CCAGACAGGAAGCAGGAAGAAGG - Intronic
956366569 3:68509846-68509868 CCTGAAAGGGAGAATGAAAAGGG + Intronic
956494994 3:69815402-69815424 GCTGAGGGGGAGAAGGAAGAGGG - Intronic
956765500 3:72481141-72481163 CCTCCCACGCAGAAGGCAGAAGG - Intergenic
956870949 3:73417285-73417307 CCTTATGGGGAGAAGCAAGAGGG - Intronic
956892897 3:73629761-73629783 ACTTACATGGAGCAGGAAGAGGG - Intergenic
957009338 3:74986122-74986144 CCTGACAGGGCTAAGGAGGAGGG - Intergenic
957233989 3:77560499-77560521 CCTTACAGGGAGACAGAAGTGGG + Intronic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
960543274 3:118883918-118883940 CCACACAGAATGAAGGAAGATGG + Intergenic
960738793 3:120810085-120810107 CCATACAGGGAGGAAGAAGAAGG + Intergenic
960937279 3:122911847-122911869 CTTCAGAAGGAGAAGGAAGTTGG + Intronic
961545067 3:127627791-127627813 CCTCAGAGGAGGAAAGAAGAGGG + Intergenic
961658314 3:128455281-128455303 CCTCAGAGGCAGCAGGAAGCAGG + Intergenic
962031813 3:131608879-131608901 CCTGACAGTGAGAAGGAAAATGG - Intronic
962271329 3:133980000-133980022 CCTCACAGGGCACAGGAGGAGGG - Intronic
962867771 3:139461837-139461859 CCTGGCAGGCAGAGGGAAGAGGG - Intronic
962983062 3:140508151-140508173 CCCCATGGGGAGAAGGAAGGAGG - Intronic
963017502 3:140839839-140839861 CAGCCCAGGGAGAAGGCAGAGGG - Intergenic
963224371 3:142846728-142846750 ACTCACAGGTAGATGGGAGATGG - Intronic
963229042 3:142891415-142891437 CCTCACAGGGTGATAGGAGAAGG + Intergenic
963587358 3:147209250-147209272 AATCAAAGGGAGAAAGAAGAGGG - Intergenic
964453799 3:156838561-156838583 ACCAACTGGGAGAAGGAAGAAGG + Intronic
964628709 3:158784934-158784956 CCTCACCTGGAGAGGGATGAGGG + Intronic
966105818 3:176332639-176332661 CCTCAAAGGTAGAGAGAAGAAGG + Intergenic
966139066 3:176734254-176734276 CCTCACAGGGCAGAGGGAGAGGG - Intergenic
966248484 3:177835163-177835185 CCTGTCAGGGAGAAGGATGTGGG + Intergenic
966500126 3:180630039-180630061 CCTCACTTGGAAAATGAAGAGGG - Intronic
967264444 3:187677970-187677992 GATGACAGGGAGAGGGAAGAAGG - Intergenic
967503115 3:190222848-190222870 CCTCCCAGTGAGAGGGAATAAGG + Intergenic
968582367 4:1401051-1401073 CCCCACAGGGAGATGATAGAAGG - Intergenic
968732063 4:2273870-2273892 CCACACAGGCAGGAGGAGGAGGG - Intronic
969228727 4:5815449-5815471 CCTCATAGGGAGACGGGAAATGG + Intronic
969339067 4:6529103-6529125 CCTCACAGGGACAGGGAAGGGGG + Intronic
970510352 4:16776087-16776109 ACTCCCAGGGAGATGGAAGGGGG - Intronic
971140881 4:23923725-23923747 CCTCAGATGGAAAAGGAAGAGGG + Intergenic
973968429 4:56186955-56186977 ACTCACAGGGAGACTGAAGTGGG + Intronic
974463536 4:62222336-62222358 CTTCACAGCGAGATGGAATATGG + Intergenic
975395903 4:73872965-73872987 AGTCACAGGGTGAAGGAAGTAGG + Intergenic
975414845 4:74094411-74094433 GGTCACAGGGTGAAGGAAGTAGG - Intergenic
976230492 4:82837731-82837753 AATCACTGGGGGAAGGAAGAGGG + Intronic
977823329 4:101501829-101501851 CCTCACATGGTGGAGGGAGAGGG + Intronic
978431497 4:108637394-108637416 ACTTTCAGGGAGAAGGAATAGGG + Intergenic
978463727 4:108985192-108985214 CTCCACAGAGAGAAGGATGAAGG - Intronic
978675316 4:111307897-111307919 CCTCACAGGCAGAAGAGAGTGGG - Intergenic
978718931 4:111882179-111882201 CATCAGAGTCAGAAGGAAGAGGG + Intergenic
978943041 4:114460429-114460451 GGTCAAAGGTAGAAGGAAGAAGG - Intergenic
979357650 4:119724330-119724352 CTTCTCAGGGGAAAGGAAGATGG + Intergenic
979858366 4:125662988-125663010 CTTCATAGGGAGAGGGGAGAAGG + Intergenic
980057465 4:128092564-128092586 CCTTACAAGGTGAAGGAAAAGGG + Intronic
980325997 4:131347014-131347036 CTTCACAGGGGAAAGGGAGATGG + Intergenic
980589966 4:134873648-134873670 ACTGACAGAGAGAAGGTAGATGG + Intergenic
981308310 4:143269496-143269518 CATCACAGGGTAAAGGAAGGAGG - Intergenic
981756750 4:148148173-148148195 CCTCACTGGGATAGGGAATAAGG - Intronic
982643268 4:157989286-157989308 CCTCACAGGAAGAAGGCTGGAGG + Intergenic
985082493 4:186280415-186280437 CCTCACAGGCAGACGGGACAAGG - Intronic
985345722 4:189002176-189002198 CCCCACAGGGAGGAGTAAGTAGG + Intergenic
985409035 4:189664333-189664355 CCTGACACGGAGAAAGGAGAAGG - Intergenic
986111003 5:4717533-4717555 CCTCACAGCAAGAAAGAATAAGG - Intergenic
986637349 5:9836169-9836191 CCTCACAAGCAGAAGGTAAAAGG - Intergenic
986893782 5:12340634-12340656 CATCACTGGGATTAGGAAGAAGG - Intergenic
988350266 5:30095687-30095709 CCTGTCAGGGAGGAGGAGGAGGG - Intergenic
988903282 5:35756776-35756798 TCTCCCAGGGAGAGGGAAGAAGG - Intronic
989144804 5:38238204-38238226 CCTCTGAGGAAGAAGGAAAAAGG + Intergenic
989168815 5:38455533-38455555 CTTCACTGGGAGAAGAATGAGGG - Intronic
989433399 5:41381920-41381942 CATCACTGAGAGAAGAAAGAAGG - Exonic
991673957 5:69074573-69074595 ACTCGAAGGGTGAAGGAAGATGG + Intergenic
992128801 5:73670134-73670156 CCACACTGGGGGAAGGGAGATGG - Intronic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
992581496 5:78182964-78182986 CATCACAGTGAGGAGGAATAAGG - Intronic
993386196 5:87266539-87266561 GCTACCTGGGAGAAGGAAGATGG - Intergenic
993435384 5:87886615-87886637 CTTCACAGGGTGAAGAAAAAGGG - Intergenic
993736257 5:91479859-91479881 CCTAACTGGGAGAAAGAGGATGG - Intergenic
994577180 5:101593419-101593441 CCACATAGGTAGAATGAAGAAGG + Intergenic
995532805 5:113107853-113107875 GGTTACAGGGAGCAGGAAGAGGG + Intronic
995686007 5:114773021-114773043 CCTCTCAGGGAGAAGAAGTAGGG - Intergenic
996085745 5:119303372-119303394 CAGCAGAGGGAGAAGGAAGGAGG - Intronic
997743482 5:136278383-136278405 CCTCACAGGGGCAATGAGGAAGG - Intronic
998173590 5:139886615-139886637 CCTCTCAAGGAGAAGCAAGGGGG - Intronic
998618813 5:143771846-143771868 CCACTCAGGGAGGAGGAGGAAGG + Intergenic
998821842 5:146064271-146064293 CCTGACAGGGTGAGGAAAGAAGG + Intronic
999213914 5:149915585-149915607 GCTCACAGTGATCAGGAAGAGGG + Intronic
999633865 5:153599932-153599954 AGTCACAGGGGAAAGGAAGAAGG + Intronic
1000778238 5:165445555-165445577 TCTCACATGGAAAATGAAGATGG - Intergenic
1000813772 5:165894289-165894311 CCTAAGAGGGAGAAAGAACATGG - Intergenic
1000920595 5:167132487-167132509 CTTCTCAGGGGGAAGGAAGAGGG - Intergenic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1001993268 5:176134440-176134462 CCTCACAAGGAGAAGCCAGGGGG + Intergenic
1002336287 5:178480679-178480701 CTTCACAGGGAAAATGAACAAGG + Intronic
1002538001 5:179888777-179888799 CCTGGCAGGGAGACGGACGAGGG + Intronic
1002953342 6:1837876-1837898 CCTCACAGGGAGCAGACAGGAGG + Intronic
1003196024 6:3915654-3915676 CCTCACAGGGCCAAGGGAAAGGG - Intergenic
1003436197 6:6090833-6090855 CCTCACAGGGCCAAGGGAAAGGG + Intergenic
1003487631 6:6593325-6593347 CCTTACAGGAAGGAGGCAGAGGG - Intronic
1003535262 6:6970603-6970625 GCACACAGGGGGCAGGAAGAAGG - Intergenic
1004370111 6:15044897-15044919 CTTCTTAGGGAAAAGGAAGATGG - Intergenic
1004567189 6:16808809-16808831 CCACACACAGAGAAGGAAGAAGG - Intergenic
1005167764 6:22944738-22944760 CATCAGAGGAAGATGGAAGAGGG + Intergenic
1005692882 6:28324028-28324050 GCTCACAGGGTGAAGGGAAAGGG - Intergenic
1005864493 6:29927510-29927532 CCACAAAGAGAGAAGGAAAATGG + Intergenic
1006054428 6:31372487-31372509 CCCAAAAGAGAGAAGGAAGAAGG + Intergenic
1006055968 6:31384783-31384805 CCTCACAGGGAAATGGAAGTGGG - Intergenic
1006461500 6:34161887-34161909 CCACATATGGAGAAGGAAGAGGG + Intergenic
1006804816 6:36781216-36781238 CCAGACAGGGAGAAGGAAGCTGG + Intronic
1007615038 6:43174634-43174656 CCTTACCGGGAAAAGGAAGGGGG - Intronic
1008137750 6:47796356-47796378 CCTAACAGGCATAAGGAAAAAGG - Intronic
1009494659 6:64332183-64332205 CCTGACATGGAGAAGGACCACGG - Intronic
1009925376 6:70114302-70114324 CCTCACAGTGAGAAGGATGATGG - Intronic
1010891640 6:81319878-81319900 CCTCACTGGAAGAAAGTAGAAGG - Intergenic
1011008925 6:82681694-82681716 AGTCACAGGAAGGAGGAAGAAGG + Intergenic
1011184292 6:84657272-84657294 CCTCACATAGAGAAGAGAGAGGG - Intergenic
1011389757 6:86838806-86838828 CCAAACTGGCAGAAGGAAGAAGG - Intergenic
1011618422 6:89219493-89219515 AATAACAAGGAGAAGGAAGATGG + Intronic
1012547498 6:100436152-100436174 ACTCACAATTAGAAGGAAGAGGG - Intronic
1013247881 6:108304758-108304780 CTTCACAAAGAGAAAGAAGAGGG - Intronic
1013967026 6:115967062-115967084 CATCACAGGAAAAAGGAAGATGG + Intronic
1014248724 6:119094737-119094759 GCTTACTGAGAGAAGGAAGATGG + Intronic
1016575529 6:145565766-145565788 CCCCTCAGGGATAAGGAAGTTGG - Intronic
1016740588 6:147524634-147524656 CTCCACAGGGAGAAGGAGGTAGG - Intronic
1016804201 6:148196546-148196568 GCTCACTGGGAGAAAGAGGATGG - Intergenic
1016903122 6:149121471-149121493 CCTGAAAGGTAGAAAGAAGAGGG + Intergenic
1017173030 6:151475758-151475780 CCTCACGTGGAGAAGGCGGACGG + Intergenic
1018346878 6:162908857-162908879 CAGCACAGGGAGATGGAAGCTGG + Intronic
1018424046 6:163664057-163664079 CTGCTCAGGTAGAAGGAAGAGGG - Intergenic
1018427199 6:163694219-163694241 CCTCACAGGGAGGAGGTGGCTGG + Intergenic
1018852702 6:167652845-167652867 GGCCACAGGGAAAAGGAAGAAGG + Intergenic
1018863642 6:167731351-167731373 ACTCACCGGAAGAGGGAAGAAGG + Intergenic
1019907370 7:4074991-4075013 CCTCCCAGGGAGAGGGGAGAAGG - Intronic
1020896577 7:13947803-13947825 CCTGAGAGGGTGAAGGAATATGG + Intronic
1020913100 7:14158306-14158328 TGCCACAGGGAGAAGGCAGATGG - Intronic
1021025103 7:15657287-15657309 CCTGACGGGGAGGAGAAAGAGGG - Intronic
1022045877 7:26621971-26621993 CCACAAAGGGAGCAGGCAGAGGG + Intergenic
1023365294 7:39457846-39457868 CCTCTCTGAGAGAGGGAAGAAGG - Intronic
1024271403 7:47645032-47645054 CCTCTCAGGGTGAAGGCATAAGG + Intergenic
1026228756 7:68465398-68465420 CTTCAGAGTGAGAAGGAAGAGGG - Intergenic
1027844617 7:83356833-83356855 CCTCAAATGCAGAAAGAAGAAGG + Intergenic
1028985489 7:97005719-97005741 ACTCAAAGGGAGGAGGAAGGAGG - Exonic
1029542372 7:101191566-101191588 CCTCACACGGAGAAGAGAGGAGG - Intergenic
1030412101 7:109193421-109193443 TGTCACAGGGGGAAGGATGAGGG + Intergenic
1031304073 7:120102036-120102058 ACTTCCAGGGAGAAGAAAGACGG - Intergenic
1031868714 7:127068755-127068777 CCACACAGTGAGGAGGAATATGG + Intronic
1032130340 7:129222802-129222824 CCTGGCAAGGAGAAGGAAGGAGG - Intergenic
1033536812 7:142320363-142320385 CCGAAGAGGGAGAATGAAGATGG + Intergenic
1033733048 7:144196620-144196642 CCTAAGTAGGAGAAGGAAGAGGG - Intergenic
1033743900 7:144295200-144295222 CCTAAGTAGGAGAAGGAAGAGGG - Intergenic
1033750001 7:144354367-144354389 CCTAAGTAGGAGAAGGAAGAGGG + Intergenic
1034237413 7:149583145-149583167 CCTCCCAGGCAGCAGGAAGATGG - Intergenic
1034240432 7:149606516-149606538 CCTCCCAGGCAGCAGAAAGATGG - Intergenic
1034424123 7:151005358-151005380 CCTCCCAGGGGGAAGGAAGCTGG - Intronic
1034488970 7:151382785-151382807 GCTCACAGGGAAATGGGAGATGG + Intronic
1035449934 7:158970608-158970630 CCTTACAGGGAGCAGTAAGTGGG - Intergenic
1036577894 8:10045391-10045413 AATCCCAGGGAGAAGAAAGAAGG + Intergenic
1036670120 8:10777979-10778001 CCTCACAGTGCAAAGGAACAAGG + Intronic
1037591738 8:20318080-20318102 AATCACAGAGAGAAGGAAGAGGG - Intergenic
1038210492 8:25515022-25515044 CTACACAGGGGGCAGGAAGAAGG - Intergenic
1038281341 8:26168045-26168067 CCTCAGAAGGAGAAGGAGGTGGG - Intergenic
1038610326 8:29054825-29054847 CATCACAGGAAGAAGGAACCTGG + Intronic
1038687715 8:29733800-29733822 CATCAGAGGGTGAAGGGAGAGGG - Intergenic
1039301381 8:36212614-36212636 ACACACAGGGAGAAAAAAGAGGG - Intergenic
1039436608 8:37563856-37563878 CCACAAAAGCAGAAGGAAGAAGG + Intergenic
1039451203 8:37676360-37676382 CCTGTGAGGGAGAAGGAAGGAGG - Intergenic
1041568917 8:59313617-59313639 GCACACAGGGAGAAGAGAGAGGG - Intergenic
1041685000 8:60635839-60635861 CAACACAGGCAGAAGAAAGAAGG - Intergenic
1042166900 8:65954581-65954603 CCTCACAGGAAGAAGAGACAAGG - Intergenic
1043661376 8:82746450-82746472 CTTCCCAGAGAGAAGGAGGAGGG + Intergenic
1044526875 8:93262232-93262254 TCTCTCAGTGAGAATGAAGAAGG + Intergenic
1044700743 8:94963551-94963573 CCTCAAGGGTAGAAGAAAGAAGG - Intronic
1047197557 8:122735237-122735259 ACACACAGGGAGAGGGAGGAAGG - Intergenic
1047794012 8:128235425-128235447 CCTCCCAGTGAGAAGGACAAAGG + Intergenic
1048104714 8:131395451-131395473 CATCACAGGCAGAACGGAGAGGG - Intergenic
1048463483 8:134642100-134642122 CCTCAATGGGAGAAGAAACAAGG + Intronic
1048952001 8:139504304-139504326 CCACACAGGGACAGGGAAGAGGG - Intergenic
1048977872 8:139683103-139683125 CCTGATAGGAAGAAGGAAAAGGG + Intronic
1049366005 8:142237200-142237222 CCACGCAGGGAGAAGCAGGAGGG - Intronic
1049415204 8:142491881-142491903 CCTGACAGGGAGAGGGAGGCAGG + Intronic
1050005803 9:1128989-1129011 CCTCACATGGAGGAAGGAGAAGG - Intergenic
1050160801 9:2717422-2717444 CCTCACAGGGTCAAGGGAGTGGG + Intergenic
1051745746 9:20293288-20293310 CCTTTCTGGGAGAAGGAACAGGG - Intergenic
1052341757 9:27370537-27370559 CTTCACATGGAGAAAGAAAAAGG - Intronic
1055197623 9:73615570-73615592 CCTTCCAGGGAGAAGGTACAAGG + Intergenic
1055208519 9:73762249-73762271 CCTCCCAGTGAGGAGGAAGGGGG - Intergenic
1055443374 9:76358476-76358498 CCTCAAAGGAAGAGGCAAGAGGG - Intronic
1056461169 9:86810933-86810955 CCTCACATGGAAAAGGAGGAAGG - Intergenic
1056831826 9:89923454-89923476 CCACAAAGGGGGAAGGAATACGG - Intergenic
1057201826 9:93144582-93144604 ACTTGCAGGGAGAAGGAAGAAGG + Intergenic
1057818630 9:98314596-98314618 CCTCACCGGGAGCAGGAGGGAGG - Intronic
1058109575 9:101017708-101017730 CCTCACATGGTGAAGGCAGAAGG + Intergenic
1058545038 9:106052292-106052314 CCTCACAGGGGGCAGGAAAGAGG + Intergenic
1058930388 9:109713200-109713222 GCTCCCAAGAAGAAGGAAGAAGG - Intronic
1059325408 9:113501352-113501374 CCTCAGAATGACAAGGAAGAGGG - Intronic
1059573771 9:115468373-115468395 CCTCACTGGTAGAGGGAAGCTGG - Intergenic
1061147589 9:128808892-128808914 CCAGGGAGGGAGAAGGAAGAGGG + Exonic
1061262177 9:129486521-129486543 CCTCACAGTGAGGAGGGAGGGGG + Intergenic
1061559102 9:131391391-131391413 CCTCACAAGAGGAAGGAAGGAGG - Intergenic
1061578155 9:131520630-131520652 CCTCTGAGGGAGGAGGAAAAAGG - Intronic
1061902515 9:133680350-133680372 CCTCACAGGCAGGTGGGAGATGG - Intronic
1061915711 9:133752372-133752394 CCTCTCTGAGAGAAGGAAAATGG - Intergenic
1062166992 9:135112836-135112858 CCTGAGGGGGAGAAGGAAGGGGG + Intronic
1185887059 X:3792422-3792444 GCTCAAAGTGAGAAGAAAGAAGG + Intergenic
1188391785 X:29630157-29630179 CCTCACATGGTGAAGGGAGAAGG + Intronic
1188611209 X:32100110-32100132 CCTGAAAGGGAGAAGTAAAAAGG + Intronic
1188637455 X:32452088-32452110 GCTCATAGGGAGAGGGAAGAGGG + Intronic
1190478722 X:50853233-50853255 CCTCAGAAAGAGAAGGAAAAGGG - Intergenic
1191977561 X:66890452-66890474 TCTCAAAGTGAGAATGAAGAAGG - Intergenic
1193410973 X:81162575-81162597 CCTCTCATGGAAATGGAAGAGGG - Intronic
1193780994 X:85701249-85701271 TCTCTCAGGGAGAAGGAGGAGGG - Intergenic
1193919137 X:87404724-87404746 CGTGACAGGGAGAAGCAAAAAGG + Intergenic
1194092035 X:89589927-89589949 CTTCTTAGGGAAAAGGAAGATGG - Intergenic
1194345270 X:92756074-92756096 CCTCATAGGTAGAAGGAACTAGG + Intergenic
1194910185 X:99631758-99631780 GCTCATAAGAAGAAGGAAGATGG - Intergenic
1195676578 X:107511553-107511575 CCTCACAGGAAGGAAGCAGATGG + Intergenic
1195746515 X:108124058-108124080 CCTCACAGGCAGAAGAAATCAGG - Intronic
1196991651 X:121335817-121335839 CCTCAGAGGAAGGAGGAAGGTGG - Intergenic
1197657150 X:129128870-129128892 CCTCACAGTGAGGAGGGAGTAGG - Intergenic
1197899047 X:131348852-131348874 CCTCAGCGGGAGCAGGATGATGG - Intronic
1198127682 X:133662404-133662426 CCTCTCATGGAGAACGCAGAGGG - Intronic
1198572194 X:137969951-137969973 GATGATAGGGAGAAGGAAGAGGG - Intergenic
1199843330 X:151672823-151672845 CCACACATGCAGAAGGATGATGG - Intronic
1200256255 X:154584826-154584848 CCTCACATCGAGGAGCAAGACGG - Intergenic
1200261514 X:154619577-154619599 CCTCACATCGAGGAGCAAGACGG + Intergenic
1200267497 X:154653874-154653896 CCTCACATCGAGGAGCAAGACGG + Intergenic
1200444667 Y:3245965-3245987 CTTCTTAGGGAAAAGGAAGATGG - Intergenic
1200653613 Y:5872724-5872746 CCTCATAGGTAGAAGGAACTAGG + Intergenic
1201896741 Y:18999970-18999992 CCTGACTTGGAGAAGGAACATGG - Intergenic