ID: 992426399

View in Genome Browser
Species Human (GRCh38)
Location 5:76662312-76662334
Sequence CAGGATAATGAGAGGAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 339}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992426399_992426405 11 Left 992426399 5:76662312-76662334 CCTCCATTCCTCTCATTATCCTG 0: 1
1: 0
2: 2
3: 33
4: 339
Right 992426405 5:76662346-76662368 TCTCTCTGTTTCTAATGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992426399 Original CRISPR CAGGATAATGAGAGGAATGG AGG (reversed) Intronic
900731110 1:4260971-4260993 CAGGAAGAAGAGAGGAAGGGGGG - Intergenic
900762350 1:4481780-4481802 CAGGATCATTAGAGGCCTGGAGG - Intergenic
902654601 1:17858873-17858895 CAGGAAAATGATAGGGGTGGGGG + Intergenic
902798606 1:18815543-18815565 CATGCAAATGAGAGGAAAGGAGG + Intergenic
903371229 1:22837412-22837434 CAAGTTTATGAGAGGGATGGGGG + Intronic
903561852 1:24233950-24233972 CAGGAAAAAGAGAGCAAGGGGGG + Intergenic
905350567 1:37343601-37343623 CTGGATAATGAAGGGATTGGAGG - Intergenic
905745592 1:40414726-40414748 CTGAAAAATGAAAGGAATGGGGG - Intronic
906209046 1:44002201-44002223 CAAGATCATGAGGGGAAAGGAGG + Intronic
906253840 1:44332346-44332368 CAGGATAATAAGAGGCTAGGGGG + Intronic
906741565 1:48190031-48190053 GAAGATGATTAGAGGAATGGAGG + Intergenic
907933992 1:59025728-59025750 CATGTGAAGGAGAGGAATGGAGG - Intergenic
908498936 1:64723499-64723521 CAAGAGCAAGAGAGGAATGGGGG + Intergenic
908579546 1:65500087-65500109 CAGGAAAGGGAGAGCAATGGAGG - Intronic
909511721 1:76460927-76460949 ATGGGTAAAGAGAGGAATGGTGG + Intronic
909876012 1:80804459-80804481 CTGGAGGATGAGAGGAAAGGTGG - Intergenic
910194429 1:84625489-84625511 AAGGAAAGTGAGGGGAATGGGGG - Intergenic
911041604 1:93595324-93595346 GAGGAAAATGAGAGGAAAGGAGG + Intronic
912086738 1:106015187-106015209 CAGGAGCAAGAGAGGAATAGGGG + Intergenic
913240270 1:116824281-116824303 CAGGATTATAAAAGTAATGGAGG - Intergenic
913321586 1:117592296-117592318 CAGGACAGTGAGAGGAAGAGTGG - Intergenic
915436679 1:155911703-155911725 CAATGTAATGAGAGGAAGGGAGG + Intergenic
915519074 1:156430838-156430860 AATCATAATGGGAGGAATGGGGG - Intergenic
915827763 1:159096833-159096855 AAGGATGATGGGGGGAATGGGGG + Intronic
916852653 1:168719297-168719319 AGTGAAAATGAGAGGAATGGAGG - Intronic
916949602 1:169766124-169766146 CAGTAAAATGAGGGGAGTGGGGG - Intronic
917856917 1:179108580-179108602 AAGGGTAAAGAGAAGAATGGTGG - Exonic
918013562 1:180610582-180610604 CAGGCTAATGGTAGGAATGTTGG + Intergenic
918861797 1:189837376-189837398 CAGTATAATTAAAGGCATGGAGG - Intergenic
920384044 1:205555174-205555196 CAGGAAAAAGAGAGCAAAGGAGG + Intergenic
920896379 1:210054740-210054762 CAGGATAATGAGGATAATGGAGG - Intronic
920951290 1:210573913-210573935 CAGGGAAATGAGAGGGATGAAGG + Intronic
922563667 1:226587282-226587304 CAGGAGACTGAGGGGGATGGAGG + Intronic
922860252 1:228810382-228810404 TAGCATAATGGCAGGAATGGGGG + Intergenic
923110239 1:230884436-230884458 TAGGATCATGAGAGGGATGTAGG + Intergenic
923292836 1:232563375-232563397 CAAGAATATGAGAGGAATGCGGG + Intergenic
923411008 1:233709051-233709073 CAGGAAAAGGAGAGGAATGGAGG - Intergenic
923811777 1:237325978-237326000 CATAATAATGAGAAGGATGGTGG + Intronic
924196076 1:241608517-241608539 GAGGATAATGTGAGGCATGGTGG + Intronic
924539207 1:244965422-244965444 CAGGACAGTGAGAGGGAGGGAGG - Intergenic
1065324480 10:24538632-24538654 AAGGAAAAAGAGAGGAAGGGAGG + Intronic
1067187900 10:44045520-44045542 CAGGATGCTGGGAGGGATGGAGG + Intergenic
1067661509 10:48239411-48239433 CAAGATAATGAGGGGCCTGGTGG - Intronic
1068604622 10:58991157-58991179 CAGGAGAAAGAGAGTAAAGGGGG - Intergenic
1069957448 10:72060702-72060724 CAGGAGAAAGAGGGGACTGGGGG + Exonic
1070750631 10:78962057-78962079 AAGGATACAGACAGGAATGGTGG + Intergenic
1071882046 10:89910355-89910377 CAGGATACGGATAGGAATGAAGG - Intergenic
1073603548 10:104870643-104870665 CAGGATAACCAGGGGAGTGGAGG + Intronic
1073613414 10:104967945-104967967 CAGGATAAGGCCAGGTATGGTGG - Intronic
1075121169 10:119666069-119666091 CAGAAAAATGAGAGGCATGTGGG - Intronic
1075642057 10:124072002-124072024 CTGGGTAAGGAGAGGAATGGAGG - Intronic
1075851673 10:125593194-125593216 CATGCTAATGAGATGACTGGTGG - Intronic
1075963025 10:126585560-126585582 CAGGAGAAAGAGAGGAAGGAAGG + Intronic
1076563492 10:131382471-131382493 CAGGATGGTGAGAGGGAGGGAGG - Intergenic
1076604252 10:131678831-131678853 CAGGAGAATGAGCGGCATGGGGG + Intergenic
1077061843 11:620992-621014 CAGGATCAGGAGAGGAAGGGCGG - Intronic
1077531341 11:3097045-3097067 CAGGAGAAGGAGAGGAAAGGGGG + Intronic
1077977659 11:7264698-7264720 CATGATCATGAGAGGCATGATGG + Intronic
1079590490 11:22177344-22177366 CAGGGTATTGAAAGGAAGGGAGG - Intergenic
1079766948 11:24406105-24406127 CTGGACATTGAGAGGAATGGAGG + Intergenic
1080898285 11:36463764-36463786 CAGGATAAAGAGATCCATGGTGG + Exonic
1081390500 11:42523401-42523423 CGGCCTGATGAGAGGAATGGTGG - Intergenic
1081814327 11:45930022-45930044 TAGGGTAATGAGATGGATGGTGG - Intronic
1085862858 11:80255148-80255170 CAGGTTGATCAGAGGAAAGGTGG + Intergenic
1086161659 11:83728544-83728566 CAGGATAGTGTGAGAAATGCTGG - Intronic
1087879957 11:103404518-103404540 CAGGATAATCAGAGTAATGTTGG + Intronic
1088800012 11:113296948-113296970 CAGGCTACTGTGAGAAATGGTGG - Intergenic
1089518971 11:119051363-119051385 CTGGATAATCTGAGGACTGGGGG - Intronic
1089850545 11:121492436-121492458 CAGGAGATTGGGAGTAATGGGGG - Intronic
1090284213 11:125485147-125485169 CAGCATAATGATAGGAACTGAGG - Intronic
1090979755 11:131709157-131709179 CAGGATAATAAGAGTAAGGTGGG + Intronic
1091154403 11:133360510-133360532 CAGGATTTTGACAGGAATTGTGG + Intronic
1094686566 12:32722185-32722207 CATGCTAATGAGATGACTGGTGG - Intronic
1096838664 12:54368131-54368153 CAGGAAAGAGAGGGGAATGGGGG - Intergenic
1097061337 12:56286498-56286520 CAGGATAATAAGAGGCCAGGTGG + Intronic
1097229200 12:57498884-57498906 CAGGACACAGAGAGGAAGGGAGG - Intronic
1099169408 12:79345691-79345713 CAGGAGTATGAGAGTAATGCAGG + Intronic
1099469862 12:83034406-83034428 TAGGAAAATGGGAGGAAGGGAGG + Intronic
1099854164 12:88142507-88142529 CAGCATATTGGGAGGAATTGAGG + Intronic
1099874694 12:88390453-88390475 GAGGCTTATGAAAGGAATGGGGG - Intergenic
1100069222 12:90690987-90691009 CAGGAGAGGGAGAGGAATAGGGG - Intergenic
1100397259 12:94196019-94196041 CAGGTTAATGATAGGCCTGGGGG - Intronic
1100818642 12:98410143-98410165 GAGGATAATTAGAGAAAAGGGGG - Intergenic
1101128644 12:101666024-101666046 CAGTATCAGGAGAGGAGTGGAGG - Intronic
1101262628 12:103048184-103048206 CAAGATAGGGAAAGGAATGGGGG + Intergenic
1101334710 12:103786228-103786250 CAGGATAAGGAGAGGAAGCAAGG + Intronic
1102063560 12:109953762-109953784 CAGGTAGATGAGAGGAATGCTGG - Intronic
1102070542 12:110015517-110015539 CAAGAGAATAAGAGGATTGGAGG - Intronic
1102701308 12:114841904-114841926 CAGGACCATGAGAGCAATGGAGG - Intergenic
1105387419 13:19944321-19944343 CAGGATAATGAAACGACTGAGGG + Intergenic
1106005218 13:25763559-25763581 AAGGATAGTGGCAGGAATGGGGG - Intronic
1106339001 13:28810254-28810276 CAGAAGAAAGAGAGGTATGGGGG - Intergenic
1106944044 13:34805560-34805582 CAGGGAAATGAGAAGAATGTTGG - Intergenic
1107315901 13:39131632-39131654 CAGGACAATGAAAGTAATGAGGG - Intergenic
1107325333 13:39235724-39235746 TATGATAATGAGATGACTGGTGG - Intergenic
1107837599 13:44424084-44424106 CAGGAAGAGGAGAGGAATGTCGG - Intergenic
1108268372 13:48734369-48734391 CAGGGTACTGATAGGAATGGTGG + Intergenic
1108612553 13:52097993-52098015 CAGGAGAAAGAGAGCAAAGGGGG - Intronic
1109741834 13:66563736-66563758 CAGAAAAATGTCAGGAATGGAGG - Intronic
1110470957 13:75860026-75860048 TAAGATAATGTGAGAAATGGGGG - Intergenic
1110556248 13:76862960-76862982 CAACATAATGAGAGGTTTGGGGG + Intergenic
1110769440 13:79322170-79322192 CTGGATAATGAGAAGAAATGTGG - Intronic
1114400022 14:22401653-22401675 CAGGATAAAGAAAGGATGGGAGG - Intergenic
1114672185 14:24417213-24417235 CAGGAGAAGGAGTGGAATGTGGG + Exonic
1115198424 14:30827282-30827304 GGGGAAAAAGAGAGGAATGGGGG + Intergenic
1115900733 14:38144738-38144760 TAGGATACTGAAAGGAATGGTGG - Intergenic
1116198643 14:41761269-41761291 CAGGAGAAAGAGAGGAAGGAAGG + Intronic
1117209422 14:53480558-53480580 CAGGAGCAAGAGAGGATTGGGGG + Intergenic
1117268192 14:54113092-54113114 CAGGAGGAAGAGAGGAAAGGGGG - Intergenic
1117365753 14:55025868-55025890 CAGTATAAAGAGATGAGTGGTGG - Intronic
1118112500 14:62737149-62737171 GAAGATAATGAGAGCAATGGAGG - Intronic
1120230692 14:81837472-81837494 CAGGATAAAGAGAGTTAAGGGGG - Intergenic
1120343078 14:83246081-83246103 CAGGAGAAAGAGAGTAAAGGGGG - Intergenic
1121039116 14:90730502-90730524 CAGGATACTGACAGGAAGGCTGG + Intronic
1121242179 14:92438956-92438978 CAGGTTAATGAGGTGACTGGTGG - Intronic
1121814074 14:96915677-96915699 CAGGAGAGTGCGAGCAATGGGGG - Intronic
1121917050 14:97844745-97844767 AAGGATAGGGAGAGGAAGGGAGG + Intergenic
1122183708 14:99972755-99972777 CAGGATCTGGAGAGGAAGGGAGG - Intronic
1123027048 14:105430322-105430344 CAGGAGAGGGAGAGAAATGGAGG + Intronic
1123664915 15:22600364-22600386 CAGTATATTGAGAGAAATAGAGG + Intergenic
1123734683 15:23174616-23174638 CAGTATATTGAGAGAAATAGAGG - Intergenic
1124285187 15:28395918-28395940 CAGTATATTGAGAGAAATAGAGG - Intergenic
1124297509 15:28515696-28515718 CAGTATATTGAGAGAAATAGAGG + Intergenic
1124427441 15:29573701-29573723 CAGGAGAAGGAGAGGAAGAGGGG - Intergenic
1125368926 15:38949148-38949170 CAGAACAATTAGAGGAAAGGGGG - Intergenic
1128412983 15:67417603-67417625 GAGGAGGATGAAAGGAATGGAGG - Intronic
1129063855 15:72884332-72884354 CAGGAGCTTAAGAGGAATGGTGG - Intergenic
1130654486 15:85782520-85782542 AGGGAGAATGAGAGGAAGGGAGG - Intronic
1131353562 15:91723667-91723689 CATGCTAATGAGATGACTGGTGG - Intergenic
1131866509 15:96716977-96716999 TAAGATCATGAAAGGAATGGAGG + Intergenic
1132205360 15:99982739-99982761 CAGGTAACTGAGAGAAATGGGGG + Intronic
1134116659 16:11553752-11553774 CAGGACAAAGAGAGGAACGCAGG + Intronic
1135853192 16:25983108-25983130 GAGGAGAATGAGTGGAATGAAGG + Intronic
1135859949 16:26047138-26047160 TTGGCTAATTAGAGGAATGGAGG + Intronic
1136580584 16:31148870-31148892 CCGGATATTGAGTGGAGTGGTGG + Intronic
1139143109 16:64292066-64292088 CATGCTAATGAGATGACTGGTGG - Intergenic
1140751238 16:78025946-78025968 CAGGAAGCTGAGAGGGATGGGGG + Intronic
1141120855 16:81355063-81355085 CAGGATGCTGAGAGCAAGGGTGG - Intronic
1143145487 17:4772454-4772476 CAGGATAATAACAGGCATGAGGG + Intronic
1143410244 17:6704246-6704268 CAGGAGGGAGAGAGGAATGGAGG - Intronic
1144255014 17:13458964-13458986 GAGGAGAATGAGAAGAATGGAGG - Intergenic
1146242846 17:31245964-31245986 TATGATAATGAGATGACTGGTGG - Intronic
1146540757 17:33692233-33692255 GAGGATAATGATAGGAACTGAGG - Intronic
1147486460 17:40819411-40819433 CCAGAGAATGAGAGGAAGGGAGG - Intronic
1148291971 17:46460140-46460162 CAGGCTAGTGGGAGTAATGGGGG + Intergenic
1148314161 17:46677831-46677853 CAGGCTAGTGGGAGTAATGGGGG + Intronic
1149727640 17:58912665-58912687 TATGATAATGAGACGAATGATGG + Intronic
1150553367 17:66231393-66231415 AAGGAGAAAGAGAGGAAGGGAGG - Intronic
1151418194 17:73980455-73980477 AAGGATAATGAGGAGAAAGGAGG + Intergenic
1152261656 17:79270469-79270491 CAGGAGAAGGGGAGGCATGGTGG - Intronic
1152371989 17:79894439-79894461 AATGATAATGAGAGTGATGGTGG - Intergenic
1153255339 18:3164504-3164526 AAGGCTAAGGAGAGGAATGGAGG - Intronic
1153574104 18:6503913-6503935 GAGGATAAAGAAAGGAAAGGAGG + Intergenic
1153847365 18:9062089-9062111 CAGAATAATGAGAAGTATGTGGG - Intergenic
1154031502 18:10757332-10757354 GAGGATGAGAAGAGGAATGGAGG + Intronic
1154271912 18:12927683-12927705 CAAGTTAAAGAAAGGAATGGAGG - Intronic
1156089396 18:33447359-33447381 CAGGATAATGGCAGGGATGTTGG + Intergenic
1156181788 18:34613261-34613283 GAGGATAGGGAGAGAAATGGAGG - Intronic
1156229619 18:35140690-35140712 CAGGATAAAAAGAGGGGTGGTGG - Exonic
1159846046 18:73461292-73461314 CAGGTTAATGTGATGAATTGAGG + Intergenic
1161870967 19:6869655-6869677 CAGGATGATGACAGGATAGGGGG - Intergenic
1165708515 19:37993073-37993095 CAGAATAGTGAGGGCAATGGAGG + Intronic
1166352433 19:42206252-42206274 AAGGAAACTGACAGGAATGGAGG - Intronic
1168046604 19:53798564-53798586 TAGGAAGATGAGAGGAAGGGAGG + Intronic
1168156752 19:54477777-54477799 CAGGATATTGAGAGGAGAGGAGG + Intergenic
1168267424 19:55230423-55230445 CAGGGTGATGAGGGCAATGGGGG + Exonic
925017684 2:543914-543936 CAGGATGATGGGAGGCAGGGAGG + Intergenic
925678742 2:6394623-6394645 GAGGTTAATGAGAGGAAAAGTGG - Intergenic
926208626 2:10852102-10852124 TAGGCTAATGAGATGATTGGTGG + Intronic
926394965 2:12431450-12431472 CAGCATAATGAGAGAGATGGTGG + Intergenic
928289873 2:30027732-30027754 CAAAATCATGAGAAGAATGGGGG + Intergenic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
928890597 2:36199090-36199112 CAGGATAATGAAGGGAAGGGAGG + Intergenic
929405922 2:41640808-41640830 CAGGATAAAGTGAGGGGTGGGGG - Intergenic
929612140 2:43278856-43278878 CAGCAGAATGAGAGAAAAGGAGG - Intronic
930237520 2:48902334-48902356 CAGGCCAATGAGAGAAATGGGGG + Intergenic
930237717 2:48903714-48903736 CAGGCCAATGAGAGAAATGGGGG + Intergenic
930793289 2:55357484-55357506 AAGGAAAATTAGGGGAATGGAGG - Intronic
932809245 2:74810394-74810416 CAAGATGATAAGAGCAATGGTGG + Intergenic
933858829 2:86443753-86443775 CAGGAGAATGAGCCGAATGCAGG - Intronic
934726640 2:96624916-96624938 CTGGATAAGGCCAGGAATGGTGG + Intronic
935832138 2:107011312-107011334 CAGGATAATGTGAGGAAGGGCGG - Intergenic
936603573 2:113924756-113924778 CAGGGGAATGAGAGGTATGGAGG - Intronic
937389969 2:121476867-121476889 CAGGATAATGAGCCCAAAGGCGG + Intronic
937815654 2:126247888-126247910 CAGGCAAATGACAGGCATGGAGG + Intergenic
937975371 2:127579115-127579137 CAGCATGGAGAGAGGAATGGCGG + Intronic
939844259 2:147224226-147224248 CATGCTAATGAGATGACTGGTGG + Intergenic
939882421 2:147645525-147645547 AAGGATAATAAGAAGAATTGAGG + Intergenic
941597993 2:167502592-167502614 CAGGAGAAAGAGAGCAAAGGGGG + Intergenic
941646801 2:168049246-168049268 CTGGATAATGACAAGAATGGAGG + Intronic
941758176 2:169211261-169211283 CAGGCTAAAGAGAGAAATAGAGG - Intronic
942350398 2:175046542-175046564 CAGGGTAATTAGAGTAATGTTGG + Intergenic
943595226 2:189847647-189847669 CAAGAGAATTAGAGGACTGGAGG - Intronic
944071166 2:195671056-195671078 CAGAATCATGAGAGGAATTCTGG - Intronic
944472694 2:200071938-200071960 CAGTATAATCAAAGGCATGGAGG + Intergenic
944925568 2:204460586-204460608 CAAGATAATGTGAGGAAAGGTGG + Intergenic
945953777 2:216066191-216066213 CTGGAGAAGGAGAGGAAGGGAGG - Intronic
946141229 2:217692377-217692399 CTGGAGAAAGAGGGGAATGGAGG - Intronic
946558243 2:220883691-220883713 AAGGATAAAGAGAAGAATGGAGG + Intergenic
946820936 2:223628453-223628475 CAGAAAAGTGACAGGAATGGTGG - Intergenic
947223884 2:227821683-227821705 CAGGAGAATGGGAGGGCTGGAGG + Intergenic
947288740 2:228547363-228547385 CTGGAGAAAGAGAGGAAGGGAGG - Intergenic
947972853 2:234338484-234338506 CAGGATATTGAGAGAAAAGAAGG + Intergenic
948336343 2:237210370-237210392 CAGGATAATTAGAGGAGGGACGG - Intergenic
1168795695 20:609133-609155 CAGGAGACTGAGAAGAAAGGAGG - Intronic
1169879140 20:10328024-10328046 CTGGAGAATGAGAGGGATGTGGG - Intergenic
1170320124 20:15086843-15086865 CAGGATATTGAGAGGACTAAAGG + Intronic
1171773314 20:29343919-29343941 CAGGAGGATGAGAGAAAGGGGGG + Intergenic
1174396147 20:50248020-50248042 CAGGAAAATGAGTTGAATGGTGG + Intergenic
1174595544 20:51680478-51680500 AAGGATAAGGGGAGGGATGGAGG - Intronic
1176294487 21:5064093-5064115 CATGACATTGAGAGGATTGGGGG + Intergenic
1177846960 21:26300713-26300735 CAGGAGAAAGAGAGCAAAGGGGG + Intergenic
1177959147 21:27640313-27640335 CAGGATATTGGGAGGGAAGGAGG - Intergenic
1178169597 21:30024907-30024929 CAGGATAATTAGAAGAATCAGGG - Intergenic
1178565865 21:33683967-33683989 CCAGATAAAGAGAGGAAAGGGGG + Intronic
1178939781 21:36895538-36895560 GAGGATTATCAGAGCAATGGGGG - Intronic
1179862564 21:44198033-44198055 CATGACATTGAGAGGATTGGGGG - Intergenic
1183573441 22:38671501-38671523 AAGGATAATGGCAGGAATAGAGG + Intronic
1203307619 22_KI270736v1_random:120447-120469 GAGTTTAATGAGTGGAATGGAGG + Intergenic
949284361 3:2383672-2383694 AAGGATAGGGAGAGGAAGGGAGG - Intronic
949526918 3:4913734-4913756 CAGGAGAGGGAGAGCAATGGGGG + Intergenic
949716637 3:6939695-6939717 CAGGATAATGATGGGATTTGAGG - Intronic
949986415 3:9544783-9544805 CAGGATGATCACAGGCATGGAGG - Intronic
950245970 3:11418874-11418896 CAGGAGAAAGAGAGCAAAGGGGG + Intronic
950456276 3:13094623-13094645 CTGTATTATGAGGGGAATGGTGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951703083 3:25515721-25515743 TATGATAATGAGAAGAATGGTGG + Intronic
952113733 3:30154889-30154911 CAGGATATAGGGAGGAAGGGAGG + Intergenic
952255337 3:31690259-31690281 CAGGAGAAAGAGAGCAAAGGGGG - Intronic
952498700 3:33938836-33938858 CAGGAGATGGAGAGGAAGGGTGG + Intergenic
953008397 3:38999600-38999622 TAAGATAATGAAAGCAATGGAGG - Intergenic
953256621 3:41296916-41296938 CAGGAAGAAGAGAGGGATGGAGG + Intronic
954418037 3:50403665-50403687 AAGGATAATGTTAGGAAGGGAGG - Intronic
954428396 3:50455895-50455917 CAGAACGAGGAGAGGAATGGGGG - Intronic
954633426 3:52058878-52058900 CAGGCTAATGTGAGGGATGGCGG - Intergenic
955559175 3:60170190-60170212 CAGGTTAATAAGATGGATGGAGG + Intronic
955801262 3:62689247-62689269 CAGGAAAATAAATGGAATGGAGG - Intronic
956122308 3:65978538-65978560 GAGGATACTGTTAGGAATGGGGG - Intronic
956683769 3:71805355-71805377 CAGGAGGAAGAGAGAAATGGGGG - Intergenic
957252282 3:77788376-77788398 CAGGATAATGAAGGTAATGCTGG - Intergenic
958835887 3:99144567-99144589 AAGGAGGAAGAGAGGAATGGTGG - Intergenic
961615219 3:128173984-128174006 CAGATAAGTGAGAGGAATGGTGG + Intronic
962635072 3:137322875-137322897 CAGGAGAAAGAGAGCAAAGGGGG + Intergenic
962747497 3:138408001-138408023 CAGGAGAAAGAGAGCAATGAAGG - Intergenic
963304668 3:143638387-143638409 CAGGATAATGCCAGGAAGAGGGG + Intronic
964211582 3:154234246-154234268 CAGGATAGTGAAAGGAAGGATGG - Intronic
966496058 3:180582050-180582072 CAGGCTTAGGGGAGGAATGGAGG + Intergenic
966547782 3:181170272-181170294 GAGGATAAAGAGAGAAATGAAGG - Intergenic
967950309 3:194835335-194835357 CAGGGTAGTGAAAGGACTGGTGG + Intergenic
968586041 4:1416495-1416517 CAGGAAAAGGAGAGGAAGGGTGG - Intergenic
968628333 4:1637905-1637927 CAGGTGGATGGGAGGAATGGGGG - Intronic
968970660 4:3791858-3791880 GAGGAGCATGAGAGGAAGGGAGG - Intergenic
969197085 4:5571611-5571633 AAGGACAAAGAGAGAAATGGAGG + Intronic
970225013 4:13848897-13848919 CAGGAGAAAGAGAGGCAGGGAGG - Intergenic
971173278 4:24256157-24256179 CTGGATAAAAAGAGGAATAGTGG - Intergenic
971551234 4:27958766-27958788 CAGGGTAATCAGAGCAATGCTGG - Intergenic
971778408 4:30998363-30998385 CAAGATAAGTTGAGGAATGGAGG + Intronic
973952380 4:56029429-56029451 CAAGCTAATGAGATGACTGGTGG - Intronic
975351868 4:73356284-73356306 CAGGGTCATGACAGGAGTGGTGG - Intergenic
975972023 4:80050978-80051000 TAGGATCATGGGAGGTATGGGGG - Intronic
977238296 4:94535494-94535516 CTGGATAATGGGGTGAATGGTGG - Intronic
977641637 4:99364061-99364083 AAGGGTAGTGAGAGGGATGGAGG - Intergenic
978119842 4:105065334-105065356 CTGCATCATGAGAGGAATGTGGG - Intergenic
978245490 4:106567396-106567418 AAGGAGAATGAGAAGAAAGGAGG - Intergenic
978765426 4:112400441-112400463 CAGGAGAATTAGAGGAATTTTGG + Intronic
978850666 4:113332107-113332129 CAGAAGAAGGAGAAGAATGGGGG - Intronic
980029426 4:127809635-127809657 CAGGATGATGAGAGCTGTGGAGG + Intronic
981572046 4:146162241-146162263 CAGGAGACAGAGAGGGATGGGGG - Intergenic
982100636 4:151964134-151964156 CAAGATTATGAGAGGTTTGGAGG + Intergenic
983424692 4:167568494-167568516 CAGGATAAGGCCAGGCATGGTGG + Intergenic
986010175 5:3706947-3706969 CAGGAGGGTGAGAGGAAGGGAGG - Intergenic
986383950 5:7212734-7212756 CAGTATGAAGAGAGGAACGGAGG - Intergenic
986472776 5:8092455-8092477 CAGGATAATGGGAGGTATTAAGG + Intergenic
987034369 5:14005397-14005419 GAGGATAATGAGATGAAAGATGG - Intergenic
989336504 5:40323390-40323412 CAGGAGAAAGAGAGCAAAGGGGG + Intergenic
989510224 5:42278090-42278112 CAGGATAATGAGATGCATTTTGG - Intergenic
989540174 5:42609255-42609277 CAGGAAAGAGAGAGGCATGGAGG + Intronic
990553263 5:56905113-56905135 CAGGATAATGAGAAGAGAGTGGG - Intergenic
991085576 5:62645720-62645742 CAGGTGAATAAGAGGAAGGGAGG - Intergenic
991522354 5:67515195-67515217 CAGGAGAAAGAGAGAGATGGGGG + Intergenic
992072902 5:73164908-73164930 CAGGCTAATAACAGGAAAGGTGG - Intergenic
992426399 5:76662312-76662334 CAGGATAATGAGAGGAATGGAGG - Intronic
993705575 5:91166087-91166109 CAGGATGATGATAGAACTGGTGG + Intergenic
994763174 5:103882568-103882590 CAGGACAATGACAGGAAAGCTGG - Intergenic
995403708 5:111769732-111769754 CAGGAGAAAGAGAGTAAAGGGGG + Intronic
995811413 5:116110788-116110810 CAGGAACAAGAGAGGAAGGGGGG + Intronic
996337809 5:122403878-122403900 CAGGATAAGGAGAAGAGGGGAGG - Intronic
996467448 5:123820282-123820304 CAAGATAATTAGAGGAGAGGAGG - Intergenic
996607060 5:125335583-125335605 CAGGAAAGTGAGAGGGTTGGTGG + Intergenic
996843819 5:127877818-127877840 CAAGATAATCAGGGGAGTGGTGG - Intergenic
997023900 5:130035228-130035250 CAGGATAATTACAGGAGAGGTGG + Intronic
998164103 5:139832236-139832258 CAGGATTATGAGGGCAATGTTGG - Intronic
998277101 5:140766631-140766653 CAGGAGAAAGAGAGCAAAGGGGG + Intergenic
999378454 5:151103432-151103454 CAGGATATTGAAATGAAAGGGGG - Intronic
999427595 5:151501010-151501032 CAGGAGAATGGGAGGCAGGGAGG + Intergenic
1000422362 5:161053417-161053439 CAGGAGAAAGAGAGCAAAGGTGG + Intergenic
1001414598 5:171536191-171536213 CAGGATCATGATAGGACTAGAGG + Intergenic
1002513005 5:179735237-179735259 CAGGATTCTGAAAGGGATGGAGG - Intronic
1002846365 6:948672-948694 CTGGAAAATGATTGGAATGGTGG + Intergenic
1004497283 6:16176328-16176350 CAGGAGAAAGAGAGCAAAGGTGG - Intergenic
1004610640 6:17236352-17236374 CAGGATAAGGAGAGGTTTAGTGG + Intergenic
1006088727 6:31615465-31615487 CAGGGTAAGGAGAGGAAGGGAGG + Intronic
1007935153 6:45726364-45726386 CTGGATATTGAGAAGAATGCTGG + Intergenic
1008299967 6:49824617-49824639 GAGGATTATGCCAGGAATGGTGG + Intergenic
1008527948 6:52426366-52426388 GAGGAAAATGAGAGTCATGGAGG - Intronic
1008616346 6:53230146-53230168 TAGGATAATCAGAGGACTGGGGG - Intergenic
1008648347 6:53539232-53539254 CAGGATGAGGAGAGGTAAGGGGG - Intronic
1009311766 6:62162811-62162833 CAGGAGAAAGAGAGGAGTGAAGG + Intronic
1009906541 6:69875921-69875943 CATTATAAAGAGAGGAAAGGAGG + Intronic
1014243467 6:119042233-119042255 CAGGATAATGGGAAGAAAGGGGG + Intronic
1014280066 6:119432376-119432398 CAGGGTATTGAGGGGATTGGAGG - Intergenic
1014300958 6:119680710-119680732 GAGAATGATGAGAGAAATGGTGG + Intergenic
1015415698 6:132945529-132945551 GAGGATAAAGAGTGAAATGGTGG + Intergenic
1015680169 6:135798680-135798702 CAGTATAAGGTGAGGAATAGGGG + Intergenic
1016416473 6:143839578-143839600 CTGGATCATGAGTGGAATGTGGG + Intronic
1017496514 6:154988399-154988421 CAGGAGAAAGAGAGATATGGGGG + Intronic
1018779480 6:167049372-167049394 CAGGGAGCTGAGAGGAATGGCGG - Exonic
1019106584 6:169672724-169672746 AAGAATAAGGAGAGGAATGAGGG + Intronic
1019948169 7:4346870-4346892 CAGGATAAAGTGAGGCACGGAGG - Intergenic
1021005425 7:15388990-15389012 TAGTATTTTGAGAGGAATGGTGG - Intronic
1021501758 7:21339501-21339523 CAGGGCAATGGGAGGGATGGGGG - Intergenic
1023064859 7:36367076-36367098 CAGGATAAGGAGGGTAAGGGCGG + Intronic
1023647678 7:42336260-42336282 CAAGAAAAAAAGAGGAATGGAGG - Intergenic
1027518052 7:79167285-79167307 CAGAAGAATCAGAGGAGTGGAGG - Intronic
1027699756 7:81455481-81455503 TAGGGTAATGACAGTAATGGTGG - Intergenic
1027879794 7:83820162-83820184 CAGGAGAAAGAGAGAAAAGGAGG - Intergenic
1029254312 7:99259001-99259023 CAGGAGAAAGAGAGCAAGGGGGG + Intergenic
1029791104 7:102843865-102843887 GAGGACAATGAGAGAAGTGGAGG + Intronic
1030297049 7:107939692-107939714 CAGTAAAATGGGAGGAATGCTGG - Intronic
1030862302 7:114649447-114649469 CTGAAAAATGAGAGGATTGGTGG - Intronic
1037002085 8:13732185-13732207 CAGGATAATCAGTTGAATCGGGG + Intergenic
1037604099 8:20422935-20422957 CAAGGTAAAGAGAGGAATGGAGG - Intergenic
1037877387 8:22554683-22554705 CAGGAGGATGAAAGGGATGGAGG + Intronic
1037915185 8:22768722-22768744 CAGGATGGGGAGAGGAGTGGGGG + Intronic
1039762483 8:40592231-40592253 AAGGATAATATTAGGAATGGGGG + Intronic
1039839297 8:41282047-41282069 TAGGGTGACGAGAGGAATGGAGG - Intronic
1041701222 8:60791216-60791238 CAGGTTTAGGAGAGGAATGAGGG + Intronic
1042170687 8:65988216-65988238 CAGGATAATTGGAGCAAGGGTGG + Intergenic
1042243536 8:66688494-66688516 TAGAATAATTAGAGGAAAGGAGG - Intronic
1043607420 8:82019187-82019209 AAGGAAAAAGAGAGGAAGGGAGG - Intergenic
1045008530 8:97937028-97937050 CTGGAGAAGGAGAGGAGTGGAGG - Intronic
1045406612 8:101873035-101873057 CAGAAAAGTGAGAGGAGTGGTGG - Intronic
1046281273 8:112035441-112035463 CAGGATCATGATGGGAAGGGTGG + Intergenic
1046374416 8:113357809-113357831 CAGGAGACAGAGAGGAAAGGGGG - Intronic
1046752409 8:117939751-117939773 CAGAATAATGAAAGGAATAAAGG - Intronic
1046920480 8:119722884-119722906 GAGGAAAAAGAGAGGGATGGAGG + Intergenic
1046930064 8:119833033-119833055 AAGCATATTGAGAAGAATGGAGG + Intergenic
1047840089 8:128742233-128742255 CAGGATGATGAGAGAAAAGAAGG + Intergenic
1049867499 8:144948304-144948326 CAGGGTGCTCAGAGGAATGGTGG + Intronic
1051434464 9:17016488-17016510 ATGGATAATGAGAGCAAAGGAGG - Intergenic
1051919928 9:22252555-22252577 CAGGAGAAAGAGAGAGATGGGGG + Intergenic
1054967788 9:71049532-71049554 CAAGTTCATGAGAGGAAAGGGGG + Intronic
1059716841 9:116921121-116921143 CAGGACCATGAGAGAGATGGGGG + Intronic
1060088660 9:120723558-120723580 CAAGATGATGAGAGGAAGGAAGG + Intergenic
1061337855 9:129953808-129953830 AAGGAGAAGGAGGGGAATGGGGG + Intronic
1061875664 9:133542358-133542380 CAGGTTTGTGAGAGGAAGGGAGG - Intronic
1062709664 9:137967822-137967844 CAGAATAATGAGACAAACGGAGG - Intronic
1186747154 X:12581938-12581960 GAGGCTAATGAGAAGTATGGAGG - Intronic
1189550451 X:42087246-42087268 CAGCATAAAGAAGGGAATGGAGG - Intergenic
1189597573 X:42585571-42585593 CATGATAATGGAAGGAATAGAGG + Intergenic
1189700533 X:43713977-43713999 CAGGAGAAAGACAGGAAGGGTGG + Intronic
1190106452 X:47564557-47564579 AAGGGTAATGAGAGGCATGACGG - Intronic
1190817145 X:53938801-53938823 CAGGATGAGGAGAGGTATGAAGG - Exonic
1194200473 X:90948776-90948798 CAGGAGAAAGAGAGGGAGGGAGG - Intergenic
1194280073 X:91940162-91940184 CAGGAGCAAGAGAGGCATGGGGG - Intronic
1194835065 X:98672085-98672107 CAGGATAGAGAGAGCAAAGGGGG + Intergenic
1195734033 X:107994952-107994974 CAGGACAATGAGATGAATGTTGG - Intergenic
1197594999 X:128454194-128454216 CAGGAGAAAGAGAGCAAAGGGGG + Intergenic
1197640347 X:128960171-128960193 CAGGAGAAAGAGAGCAAGGGGGG + Intergenic
1198687631 X:139244450-139244472 CAGTATAGTGAGCTGAATGGTGG + Intergenic
1199539383 X:148942238-148942260 CAGGATAAGCAAAGGCATGGAGG + Intronic
1199661336 X:150053710-150053732 AAGGAGAATGAGAGGGATGATGG - Intergenic
1200153832 X:153964767-153964789 TTGGGGAATGAGAGGAATGGGGG - Intronic
1200597548 Y:5163663-5163685 CAGGAGCAAGAGAGGCATGGGGG - Intronic
1200935000 Y:8730589-8730611 CAGGATGAAGAGAGGAAGTGAGG - Intergenic