ID: 992433699

View in Genome Browser
Species Human (GRCh38)
Location 5:76734546-76734568
Sequence TGTGTTTACACCCAGTGGAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992433699_992433702 13 Left 992433699 5:76734546-76734568 CCCATCCACTGGGTGTAAACACA 0: 1
1: 0
2: 1
3: 12
4: 127
Right 992433702 5:76734582-76734604 CTGAAATGTCAGTTCTGATATGG 0: 1
1: 0
2: 0
3: 28
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992433699 Original CRISPR TGTGTTTACACCCAGTGGAT GGG (reversed) Exonic
902416638 1:16243564-16243586 TGTGTCTTCACACCGTGGATGGG - Intergenic
902746651 1:18479075-18479097 TGTCTTTACACTGAGTGGATTGG - Intergenic
903544733 1:24116861-24116883 TGAGTTTCCACCCAGAGAATTGG - Intergenic
905992002 1:42345874-42345896 TGTGTTCAACCCTAGTGGATAGG - Intergenic
906941295 1:50257794-50257816 TGTGTTTAGACCAGGGGGATTGG + Intergenic
908625458 1:66035847-66035869 TGTGTGTACACCCAGTAGTGGGG + Intronic
910127118 1:83854926-83854948 AGTGTTTATAATCAGTGGATTGG - Intergenic
911487092 1:98515872-98515894 TGGGCTTAGAGCCAGTGGATGGG + Intergenic
912098982 1:106182683-106182705 TGTTTTTGCACTCAGTGGAAGGG + Intergenic
912467537 1:109884221-109884243 AGTGTTTAGGCACAGTGGATAGG - Intergenic
917658367 1:177151482-177151504 TGTGTTTACACTCACAGGAAGGG - Intronic
918775218 1:188620183-188620205 TGTGTTTTCACATAGTGGAATGG - Intergenic
920717823 1:208357566-208357588 AGTGTTTACACAGAGTGGATGGG - Intergenic
922493902 1:226040895-226040917 TCTGCTTACACCCTGTGGGTGGG + Intergenic
924584316 1:245348530-245348552 TGTGTTTTCACACAGTGGAGGGG + Intronic
1062957437 10:1549497-1549519 GGTGTTTCCACCCAGTGGCATGG + Intronic
1063023573 10:2155090-2155112 TGTGTCTTCACGCAGTGGAAGGG - Intergenic
1064879678 10:20036625-20036647 GTTGTTTACTTCCAGTGGATTGG + Intronic
1065005462 10:21375771-21375793 TGTGTGTACACCCCCTGAATGGG + Intergenic
1065037504 10:21654796-21654818 TATATTTAAACCCAGTGGGTAGG + Intronic
1068488282 10:57687848-57687870 AGTGTTCACCCACAGTGGATTGG + Intergenic
1070710026 10:78674406-78674428 TGTGTTTAAACCCAGAGGGCTGG - Intergenic
1074073001 10:110092204-110092226 TGGGTATACACCCAGTAAATGGG - Intronic
1074430666 10:113391448-113391470 TGTGTTTATACCTAATTGATTGG - Intergenic
1074634139 10:115294958-115294980 TGTGAGTACACACAGTGGGTAGG + Intronic
1075519273 10:123134482-123134504 TGTTTTTAAAGCCAGTGGAGTGG + Intergenic
1077278294 11:1728326-1728348 GGTGATTACACCCAGGGGGTCGG - Intergenic
1079621515 11:22561163-22561185 TGTCTTGACACCCCTTGGATGGG - Intergenic
1085762379 11:79253212-79253234 TGTTTTTGGCCCCAGTGGATGGG - Intronic
1090991443 11:131820356-131820378 TGTCTTAACTCCCTGTGGATTGG + Intronic
1092084066 12:5741265-5741287 TGTGTATTCAACCAGTGCATAGG - Intronic
1093590267 12:20894524-20894546 TGTATTTTCACCCAGGGGAAGGG - Intronic
1100154431 12:91781131-91781153 TCTGTTTACACACAGTCCATTGG - Intergenic
1100913083 12:99387644-99387666 TGTGTTCTCACACAGTGGACAGG - Intronic
1103248871 12:119482795-119482817 TGTGTGTACACCCAGCTGATGGG + Intronic
1105279329 13:18954135-18954157 TGTGTGTACTCCCAGTGCGTGGG - Intergenic
1107882818 13:44847981-44848003 TGTGTGCACACCCACCGGATGGG - Intergenic
1109402942 13:61858437-61858459 TGTGCTCAGAGCCAGTGGATTGG - Intergenic
1111305318 13:86404629-86404651 TGACTTTTCACCCACTGGATGGG + Intergenic
1113481604 13:110625840-110625862 TGTGTTTGCACCGACTGGATTGG + Intronic
1113708999 13:112452047-112452069 GGTATTTTCACCCAGTGGAGCGG - Intergenic
1114262235 14:21045353-21045375 TGTTTTTACACTCAGTCGTTTGG - Intronic
1126240153 15:46432858-46432880 TGTGTTTACACCCATTAGAAAGG + Intergenic
1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG + Intronic
1128557443 15:68641400-68641422 TGTGTCTACACCCTGAGGACTGG + Intronic
1128715491 15:69904749-69904771 TGTGTTGGCAGACAGTGGATAGG + Intergenic
1129377326 15:75142177-75142199 TGTTTTAACTCCCAGTGAATAGG + Intergenic
1130769213 15:86907317-86907339 TGTGTCTCCAACCATTGGATTGG + Intronic
1131415197 15:92249745-92249767 TGAGTATACACCCAGTGGAGGGG + Intergenic
1135853869 16:25988494-25988516 TGTGTTTTCACCCAGAAGATAGG - Intronic
1136077309 16:27826091-27826113 TGTGTTTAGACCCAGTGATTAGG + Intronic
1136598494 16:31267991-31268013 AGTGTTTACAGCCAGAGGAAGGG - Intronic
1137475808 16:48809610-48809632 TGTGTTCTCACACAGTGGAAGGG + Intergenic
1137856310 16:51797715-51797737 GGTGCTTACATCTAGTGGATTGG + Intergenic
1140155946 16:72426805-72426827 TGTGTTTATACGCAATCGATAGG - Intergenic
1140846574 16:78894472-78894494 TGTGTTTCCAACCAGTAGAGAGG - Intronic
1141075631 16:81004545-81004567 TGTGTGCATACACAGTGGATGGG - Intronic
1142672516 17:1493639-1493661 CCTGTTTCCACCCAGTGGGTCGG + Intergenic
1143733066 17:8892130-8892152 TGCGTTTAAACCCAGTGCAAAGG + Intronic
1145069121 17:19788183-19788205 TGGGCTTAAAGCCAGTGGATTGG + Intronic
1147919526 17:43907372-43907394 GGAGTTTAAACCCAGTGAATAGG + Intronic
1150039001 17:61837940-61837962 TTAGTTTCCACCTAGTGGATTGG - Intronic
1151125324 17:71838524-71838546 TGTGTTTACATGGAGAGGATGGG - Intergenic
1151984581 17:77534095-77534117 AGGGTATACACACAGTGGATGGG - Intergenic
1153575169 18:6512624-6512646 TATGTGTACAGCCAGTGGAGGGG + Intronic
1157651212 18:49333582-49333604 TCTCTTTAAACCCAGTGCATAGG - Intronic
1158102455 18:53844655-53844677 TTTGTTTACACCCAGTAGATTGG - Intergenic
1158673862 18:59500976-59500998 TGTGATTACACCCAGTTTACAGG + Intronic
1159412605 18:68100682-68100704 TGTGTTTTCACCAAGTGTATAGG + Intergenic
1160183343 18:76655118-76655140 TGTGTTCTCACGCAGTGGAAGGG + Intergenic
1160291394 18:77597886-77597908 TGTGTTGAAACCGAGTTGATGGG + Intergenic
1162866443 19:13551421-13551443 CCTGTTTATACCCAGTGGAATGG - Intronic
1164764882 19:30756752-30756774 TGTGCATACACCTAGGGGATAGG - Intergenic
1165491360 19:36125207-36125229 GGTGTCTTCACCCAGTGAATGGG + Intronic
930871094 2:56171828-56171850 AGTGTTTACTCACAGTGTATAGG + Intergenic
930983426 2:57555615-57555637 TCTGTTGACACCCAGTTTATGGG + Intergenic
931773690 2:65521357-65521379 TGTGTATACACACATTGGAATGG - Intergenic
935051950 2:99531590-99531612 TGTGTTGACCCGCAGTGGGTCGG + Intergenic
935558267 2:104534229-104534251 TATGTTTAAAAACAGTGGATAGG + Intergenic
941192086 2:162397387-162397409 TGTTTTAACACTTAGTGGATTGG + Intronic
943270965 2:185803357-185803379 TGTGTTTACCTCCAGTGGAGAGG + Exonic
943839867 2:192565547-192565569 TGGCTTTAAACACAGTGGATGGG + Intergenic
946876696 2:224136645-224136667 TGTGTTTAACACCAGGGGATGGG - Intergenic
947104033 2:226649788-226649810 TGTGATTACATCCAGAGGCTGGG + Intergenic
1173404247 20:42751386-42751408 TGTGTTCACCCCTACTGGATCGG - Intronic
1177126643 21:17201905-17201927 TTTGTTTACAGGCATTGGATAGG + Intergenic
1178592536 21:33923684-33923706 TCTGTTTAAACCCAAAGGATGGG + Intergenic
1179892677 21:44344852-44344874 TGTGGTTTCAGCCAGTGGGTCGG + Intergenic
1182634667 22:31715904-31715926 TTTGTTTACAACCAGTTCATTGG + Exonic
1185026376 22:48415893-48415915 TGTTTTTACACGAAGTGGTTTGG + Intergenic
950753835 3:15155705-15155727 TGTGTGTTCACCCAGTGCGTGGG - Intergenic
952317364 3:32242743-32242765 TGTGTTTTCTCCCAGTGTACTGG + Intronic
955952676 3:64257943-64257965 TGTGTCTTCACACAGTGGAAGGG - Intronic
965919983 3:173901382-173901404 TGTGTTTAAAAACAGTGGCTTGG + Intronic
967935706 3:194725836-194725858 CGTGTTTATACGCAGTGGAGAGG + Intergenic
969975248 4:11093066-11093088 TGTGTTTTCACACGGTGGAAGGG - Intergenic
976430094 4:84952919-84952941 TGTGTATACACCCAGAAGAAAGG - Intronic
980773406 4:137408534-137408556 TGTGTTTACTGACAGTGGAAAGG + Intergenic
981307815 4:143265221-143265243 TCTTTTTAAACTCAGTGGATGGG + Intergenic
984368432 4:178829030-178829052 GGTATTTAAACCCAGTGGACTGG + Intergenic
990661525 5:58020903-58020925 TGTGTCTTCACACAGGGGATGGG - Intergenic
990903236 5:60776046-60776068 TGTGTTTTCTCCCAGTCCATAGG - Intronic
991236051 5:64398629-64398651 TGGGTATACACCCAGTGTTTTGG - Intergenic
991712670 5:69423204-69423226 TCTTTTTACACCTAGTGGAATGG + Intronic
992433699 5:76734546-76734568 TGTGTTTACACCCAGTGGATGGG - Exonic
993597848 5:89881832-89881854 TGTGTTTTCACATAGTGGAAGGG + Intergenic
996042931 5:118836740-118836762 TGTGTCTTCACCTAGTGGAAGGG - Intergenic
996211410 5:120815793-120815815 TGTGTTTTTACCCAGTAGGTAGG + Intergenic
998827457 5:146117632-146117654 TGTGTGTGGACCCACTGGATAGG - Intronic
999277630 5:150342131-150342153 TCCTTTTACACCCACTGGATTGG + Intergenic
999333061 5:150691099-150691121 TGTGTTTCCATCCAGTTGACAGG + Exonic
999520582 5:152346753-152346775 TGGGTTCACCCCCAGTGGAAAGG - Intergenic
1000372357 5:160549309-160549331 TGTGTGGACACCCACAGGATGGG + Intergenic
1001625625 5:173130349-173130371 TGTGTTTTTACCTTGTGGATTGG + Intronic
1002581642 5:180212476-180212498 TGTGTCGACACCCAGAGGACAGG - Intergenic
1002701849 5:181130259-181130281 TGTGTTTGCTCCCACTGGGTCGG + Intergenic
1006831075 6:36968707-36968729 TGGGGCTGCACCCAGTGGATTGG - Exonic
1008283050 6:49618975-49618997 TGTGTTCTCACACAGTGGAAGGG + Intronic
1010404598 6:75489138-75489160 TGTGTTTATACACAGTGCTTGGG - Intronic
1011017336 6:82771508-82771530 TGTGTGTCCACCCAATTGATGGG - Intergenic
1012144267 6:95661939-95661961 TGGGTGTATACCCAGTGGAATGG - Intergenic
1015961077 6:138650022-138650044 TGAGGCTGCACCCAGTGGATTGG - Intronic
1017877113 6:158534139-158534161 TATCTTCACACCCAGTGCATGGG - Intergenic
1019103626 6:169651018-169651040 TGTGTTTACACAGAGTGGCCTGG + Intronic
1022415910 7:30176818-30176840 TGTGTTCACACCCTGTGTAGTGG - Intergenic
1026279685 7:68911130-68911152 TGTGTATAAACCCATGGGATTGG + Intergenic
1028921773 7:96317543-96317565 TTTGTTTCCAACCACTGGATTGG + Intronic
1034110142 7:148529074-148529096 TGTGCTTAACCCCAGTGCATGGG + Intergenic
1034275053 7:149820333-149820355 TTTGTGTCCACCCAGAGGATGGG - Intergenic
1034907272 7:154961009-154961031 TGTGTCAACGCCCAGTGGCTTGG - Exonic
1040884871 8:52250549-52250571 TCTGTTTGCACCCTGTGGGTTGG - Intronic
1044097067 8:88079808-88079830 TGTGTTCTCACACAGTGGAGGGG - Intronic
1044941891 8:97351922-97351944 TGTGTTTACCCCCGGTCAATGGG + Intergenic
1047371915 8:124263031-124263053 TTTATGTACACCCTGTGGATGGG - Intergenic
1058438518 9:104986315-104986337 TGTGCCTACACCCAGAGGACAGG + Intergenic
1187451152 X:19397666-19397688 TGTGTTTCCACCCATTGGCTAGG - Intronic
1188760834 X:34027376-34027398 TGTGTCTACACATGGTGGATGGG - Intergenic
1190895907 X:54617734-54617756 TGTGTTCTCACACAGTGGAAGGG - Intergenic
1199728125 X:150604906-150604928 TGTGTATACACCCCGTGCTTTGG + Intronic
1201510305 Y:14752772-14752794 TGTTTTTACTCACAGTTGATAGG - Intronic
1201962598 Y:19698692-19698714 TGTGTTCTCACACAGTGGAAGGG + Intergenic