ID: 992433723

View in Genome Browser
Species Human (GRCh38)
Location 5:76735001-76735023
Sequence CTCATTAAGTCTTAAGTAAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 225}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992433723 Original CRISPR CTCATTAAGTCTTAAGTAAA TGG (reversed) Exonic
901488972 1:9586475-9586497 ATCTGTAATTCTTAAGTAAAAGG - Intergenic
902189108 1:14748716-14748738 CTCATTTAGTCTTCAGCACAGGG - Intronic
906571238 1:46843299-46843321 CTCATTAATTCTTATATGAAAGG + Intergenic
907672765 1:56491509-56491531 CTCATTAATTCCTAAGGACAGGG + Intergenic
907763977 1:57389912-57389934 CTCATTTATTCCTCAGTAAACGG + Intronic
909614019 1:77586649-77586671 ATCATTTTGTCTTAACTAAATGG - Intronic
909891801 1:81016395-81016417 CTCATTAAGACTAAATAAAATGG + Intergenic
910740652 1:90512473-90512495 CTCATTGGGTTTTAAGTAAATGG - Intergenic
912424940 1:109579145-109579167 GTCATCAAGTCTTAAAGAAATGG + Intronic
914781367 1:150788487-150788509 CTTATTTAGTCTTAAAGAAAAGG + Intergenic
914896471 1:151679357-151679379 CTTATTAATTTTTAAGGAAAAGG - Intronic
915384506 1:155477725-155477747 CTTCTTAAATCTTAAGGAAAAGG + Intronic
916305080 1:163321516-163321538 CTCATTTAGACTTCATTAAAGGG - Intronic
916334868 1:163659434-163659456 CTCATTAAGCTTTAAGTCAATGG + Intergenic
917951542 1:180042588-180042610 CACTTTAAGTCATTAGTAAAAGG + Intronic
918354183 1:183690406-183690428 TTCATGAAGTCTTAAAGAAAGGG + Intronic
919814162 1:201427299-201427321 CACAGTAAGTGTTCAGTAAATGG + Intronic
921214192 1:212923447-212923469 CTCATTAAGTCTTTAAGAAAAGG - Intergenic
921507209 1:215986593-215986615 CTGATGAAATCTTAAGCAAAAGG + Intronic
921939965 1:220829208-220829230 CTCACTAAGTATTTAGCAAAGGG - Intergenic
922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG + Intronic
922457059 1:225783086-225783108 CTTTTTAAGTCTTAAATAAATGG + Intronic
923817497 1:237397365-237397387 CTCAAGAAGCCTTGAGTAAATGG + Intronic
924272945 1:242352862-242352884 CTGATTAAGAAATAAGTAAAGGG - Intronic
1065271393 10:24037066-24037088 GTTACAAAGTCTTAAGTAAAAGG + Intronic
1065841198 10:29702855-29702877 CTCCTAAAGTCTGAAGTCAAAGG - Intronic
1066055444 10:31676545-31676567 CTTAATAAATCTTAAGTAAGTGG + Intergenic
1066711770 10:38243801-38243823 CTGATTAAGAAATAAGTAAAGGG + Intergenic
1068022070 10:51597406-51597428 CTCAATAGCTCTTAAATAAATGG - Intronic
1068191522 10:53658693-53658715 CACAATAGGTGTTAAGTAAATGG - Intergenic
1068607827 10:59025774-59025796 CTCAGTAAATGTTAAGTAATTGG - Intergenic
1070206441 10:74267581-74267603 CTCATACTGGCTTAAGTAAATGG + Intronic
1073369332 10:102972772-102972794 CTCAATGAATGTTAAGTAAAAGG - Intronic
1074519171 10:114201538-114201560 TTCATTAAGGATTATGTAAAAGG + Intronic
1077905246 11:6527853-6527875 CTCATTAACTCTTTAGGAACTGG - Intronic
1078784850 11:14479397-14479419 CTCATTTAGTCTATAATAAATGG - Intronic
1079445521 11:20553323-20553345 CTTTTTATGTTTTAAGTAAAAGG - Intergenic
1080937131 11:36875894-36875916 TACAGTAAGTCTTCAGTAAATGG + Intergenic
1081072263 11:38626467-38626489 TTCTTTAACTCTGAAGTAAAAGG - Intergenic
1081135526 11:39435896-39435918 CTCAGAAAGTCTTTAATAAAAGG - Intergenic
1081296088 11:41391218-41391240 CTCAGTAAGTCCAAAGTGAATGG + Intronic
1083625463 11:64069828-64069850 GTCATTAAGTCTTTAGCAAATGG + Intronic
1084842945 11:71872445-71872467 CTCATTTATTCTTAAGAAATAGG + Intronic
1086494956 11:87393401-87393423 CTAATTATGTCTTAAGGAATAGG - Intergenic
1086892923 11:92279122-92279144 CTTATAAAGTCTTAGATAAAAGG - Intergenic
1086899806 11:92354201-92354223 CTCATTAAGGCAAAAGCAAATGG + Exonic
1088096872 11:106111186-106111208 TTCATTGACTCTTAAGTATAAGG + Intergenic
1093185179 12:16012137-16012159 CTCAGTAAGTGTTAGTTAAATGG + Intronic
1093247273 12:16754950-16754972 CTCATAAATTGTTAGGTAAAAGG + Intergenic
1095411247 12:41926467-41926489 CTAAATAACTCATAAGTAAAAGG + Intergenic
1097368298 12:58743873-58743895 ATTATTCAGTCTTAAGAAAAGGG + Intronic
1097415429 12:59310384-59310406 CTGATTCAGTCTTTAGTAAGTGG + Intergenic
1097693077 12:62752179-62752201 CTCATTTAGTCTGAAGAAAGTGG - Intronic
1098335470 12:69400153-69400175 CACATAAAGTATTCAGTAAATGG - Intergenic
1098703898 12:73663838-73663860 CTCAGTGATTCTTAAGTCAATGG + Intergenic
1099343071 12:81463314-81463336 TTCATCAAGTCTGAATTAAAAGG + Intronic
1100821518 12:98436062-98436084 CTCATGAAGTCTTATTTACAGGG + Intergenic
1103151414 12:118642390-118642412 CTCATGCATTCTTAAGAAAAAGG - Intergenic
1104143595 12:126010864-126010886 CACATTATGTTTTATGTAAAGGG + Intergenic
1105253775 13:18725929-18725951 ATAATGAATTCTTAAGTAAAAGG - Intergenic
1105395732 13:20032539-20032561 GTAACTAAGTCTTAAGTGAAAGG + Intronic
1106994357 13:35463677-35463699 CTCATTAATTAGTAAGTTAAAGG - Intronic
1107161141 13:37229538-37229560 CTCTTCAAATCTCAAGTAAAAGG - Intergenic
1108464360 13:50699930-50699952 CTCATTAAGTACTCAATAAATGG - Intronic
1109063061 13:57644855-57644877 CTGGTTAAGTTTGAAGTAAAAGG + Intronic
1109286541 13:60416044-60416066 GTTATTAATTCTTAAGCAAAGGG - Intronic
1110480036 13:75963239-75963261 CTCAATAATTCTTATGTTAATGG + Intergenic
1111298035 13:86308786-86308808 ATAATTAACTCTTCAGTAAAAGG + Intergenic
1111830121 13:93318517-93318539 CTCACTAAGGCTAAAATAAAGGG + Intronic
1114167938 14:20240883-20240905 CTGATTAAGTCTTAAAAAAGTGG - Intergenic
1114709040 14:24759218-24759240 CTCATTAAGTCTTCATATAATGG - Intergenic
1114812114 14:25913085-25913107 CTCATTAAGACCTAACTCAAAGG - Intergenic
1115172889 14:30528894-30528916 CTCCTTAAGTGTTCAGTACATGG - Intergenic
1119010852 14:70986559-70986581 ACCATTAAGTCTTCAGTAGAAGG + Intronic
1119885864 14:78141475-78141497 CACAGTAAGTCCTCAGTAAATGG + Intergenic
1120099342 14:80426268-80426290 CTCAAAAAATATTAAGTAAATGG - Intergenic
1121821937 14:96977101-96977123 CTCATTTAGTCTTTACTAGATGG + Intergenic
1122368209 14:101210489-101210511 TTAATGAAGTCTTAAATAAATGG - Intergenic
1124487470 15:30132072-30132094 CTCTTTAGGTCTTAAGGCAAAGG - Intergenic
1124542559 15:30601046-30601068 CTCTTTAGGTCTTAAGGCAAAGG - Intergenic
1124756059 15:32406251-32406273 CTCTTTAGGTCTTAAGGCAAAGG + Intergenic
1125878420 15:43169801-43169823 CTCAAGAAGCCTTGAGTAAATGG + Intronic
1126511972 15:49487911-49487933 CTCATTCACGCTCAAGTAAATGG - Exonic
1128650172 15:69405994-69406016 ATCATTAAGTATTAAATAATAGG + Exonic
1146772009 17:35577757-35577779 CTCAGTAACTCTTAAGTCATGGG + Intronic
1151692536 17:75695594-75695616 CTAATTACGTCTTCAGTAAGAGG - Intronic
1151810720 17:76439647-76439669 CTCAATAATTTTTAAGTTAAAGG + Intronic
1154301066 18:13192956-13192978 AGCATTAAGTTTTACGTAAAAGG + Intergenic
1157051110 18:44166291-44166313 CTCATTAACTCTAAAGTATTAGG - Intergenic
1157481367 18:48056222-48056244 CTCCTTAAGACTTAAGTCAATGG + Intronic
1157809641 18:50685418-50685440 CCCTTTAAGTCTTAAGCAGAGGG + Intronic
1158313988 18:56190351-56190373 CTTATTAAGTCTTAGATCAACGG - Intergenic
1158983989 18:62794902-62794924 CACATTAAGGATTAAGTAGATGG + Intronic
1161555429 19:4939502-4939524 CAAATTAAGTGTTAAGGAAAAGG - Intronic
1165261150 19:34619449-34619471 ATCAGTAAGTCTTAACTAAGAGG + Intronic
1165725463 19:38109812-38109834 GTCAATAAGTGTTAAGTAATGGG + Intronic
1165981271 19:39726438-39726460 GGCATTAAGTTTTCAGTAAATGG - Intergenic
925772752 2:7299408-7299430 CTCTTTCAGTCTTAATTAAGAGG + Intergenic
930050189 2:47209379-47209401 CACAGTAAGTGTTCAGTAAATGG - Intergenic
932320841 2:70820922-70820944 CTCAGAACCTCTTAAGTAAAAGG + Intergenic
934576858 2:95407508-95407530 CTGATGGAGTCTTAAGTAAAAGG - Intronic
934639076 2:96015673-96015695 CTGATGGAGTCTTAAGTAAAAGG - Intergenic
934794570 2:97089739-97089761 CTGATGGAGTCTTAAGTAAAAGG + Intronic
935002889 2:99038429-99038451 CTCATACAAACTTAAGTAAAGGG + Intronic
936718537 2:115220011-115220033 CACAGTAAGTGTTCAGTAAATGG - Intronic
937535354 2:122879820-122879842 CCCATCAAGTCTGAAGTACAGGG - Intergenic
939246424 2:139630039-139630061 GTCAATAAGTATTAACTAAATGG + Intergenic
939454211 2:142412165-142412187 CTATTAAAGTCTTAATTAAAGGG - Intergenic
942852454 2:180505152-180505174 CTCAGTAGGTCTTAAGTGAAGGG + Intergenic
944401657 2:199333821-199333843 CTCATTAAGTTACAATTAAATGG - Intronic
944752805 2:202728564-202728586 CTCATTCATTCATAAATAAATGG + Intronic
945338640 2:208622836-208622858 GTAATTAAGACTTAAATAAATGG - Intronic
945393172 2:209289151-209289173 ATAAATAAGACTTAAGTAAATGG - Intergenic
946291844 2:218751504-218751526 GTCATCAAATATTAAGTAAAAGG - Intronic
1170248501 20:14251576-14251598 CTCATTAAGGATTTAATAAAAGG + Intronic
1170309120 20:14973717-14973739 CACATTAAGTATTTATTAAATGG - Intronic
1172924732 20:38522772-38522794 CTCAATCTGACTTAAGTAAAAGG + Intronic
1172953268 20:38736286-38736308 ATCATTAAGCCTAAAGTTAATGG - Intergenic
1173093954 20:40006188-40006210 GTCATTAAGTCATAAATAACAGG - Intergenic
1174943066 20:54953724-54953746 GTGAATAAGTCTTAACTAAATGG + Intergenic
1176839285 21:13825919-13825941 ATAATGAATTCTTAAGTAAAAGG - Intergenic
1177606306 21:23382066-23382088 GTCATTAAGTATGAAATAAAAGG + Intergenic
1177666786 21:24169783-24169805 CTCATTAAGTCTGAAGGAGAGGG + Intergenic
951292757 3:20893711-20893733 CACAGTAAGTATTCAGTAAATGG + Intergenic
956390396 3:68766291-68766313 CTCATTAAGTCTTTGATAATAGG + Intronic
956778060 3:72582520-72582542 CACAATAAGTCTTACGTATACGG + Intergenic
957128726 3:76196869-76196891 CTCACTAGGTATTAAGTAAATGG + Intronic
957816473 3:85305214-85305236 CTCATGATGTCTTATTTAAAAGG - Intronic
959355240 3:105319174-105319196 TTCAATAATTTTTAAGTAAAAGG + Intergenic
959358261 3:105359089-105359111 CTCCTTAACTTTTAAGAAAAGGG + Intergenic
960658071 3:120028247-120028269 CTCATTAATTGTTATTTAAATGG - Intronic
961122899 3:124388523-124388545 CTCAATAAGTATTGAATAAATGG + Intronic
962724635 3:138211290-138211312 CTTATTAAGTGTTCAATAAATGG + Intronic
963649794 3:147964140-147964162 ATGATTAAGTATTAGGTAAATGG - Intergenic
964158436 3:153615999-153616021 CTCATTAGGTTTTACATAAAGGG + Intergenic
966742484 3:183247035-183247057 CTCAATAAGTGTTAATTGAATGG + Intronic
966933920 3:184693191-184693213 CTCATTAACTCAGAAGTGAAGGG - Intergenic
967491448 3:190095923-190095945 CTCATTACGACTCAAGTGAAAGG + Intronic
967759152 3:193204300-193204322 CTCAATAAATCTTATGTAGAAGG + Intergenic
971555577 4:28010634-28010656 CTCAGCAATTCTTGAGTAAAAGG + Intergenic
973077117 4:45943003-45943025 CTCACTAATTCTCAAGTAAGAGG - Intergenic
975361752 4:73478359-73478381 CTCATGTAGTCTTCAGTTAATGG + Intergenic
976576331 4:86676670-86676692 ATCATACAGGCTTAAGTAAAAGG + Intronic
977370095 4:96124503-96124525 CTCATCATGTCTGAAGTAAATGG + Intergenic
977410531 4:96656045-96656067 ATCCTGAAGTCTTAAGTGAATGG - Intergenic
977560524 4:98528914-98528936 CTCATTCAGTCTTCACAAAAGGG + Intronic
977669452 4:99679198-99679220 CTCATTAAGTCTTGAGTTTCTGG + Intergenic
978166337 4:105612463-105612485 CACAGTAAGTCATGAGTAAAAGG + Intronic
978330728 4:107610318-107610340 CTCATTTTATCTTAAGTGAAGGG + Intronic
978451845 4:108842813-108842835 TTCATTAAGAATTAAGCAAATGG - Intronic
979841855 4:125451643-125451665 CTCAGCAAGTAATAAGTAAAGGG - Exonic
981320838 4:143389312-143389334 CTCACTAGGTTTTAATTAAAAGG - Intronic
983769350 4:171529868-171529890 CTTATTTAATCTTAAATAAAAGG + Intergenic
984531031 4:180916496-180916518 CACATTAAGTCCTAAATTAATGG + Intergenic
985043902 4:185920829-185920851 CTCTTTCAGTGATAAGTAAATGG + Intronic
986683893 5:10259132-10259154 CTCATTAACTCTTGCCTAAAAGG - Intronic
987990537 5:25205500-25205522 CTCATTAAATCATAGATAAAAGG + Intergenic
988629128 5:32910479-32910501 CTCATTAAATATTTATTAAATGG - Intergenic
992102515 5:73420852-73420874 CTCAATGACTCTTAAGAAAAGGG + Intergenic
992137000 5:73756211-73756233 CATATTAAGTTTTCAGTAAAAGG + Intronic
992161851 5:74012024-74012046 CTTAGTAAGTCTTCAGTAAGTGG - Intergenic
992433723 5:76735001-76735023 CTCATTAAGTCTTAAGTAAATGG - Exonic
992629044 5:78663084-78663106 CCCAGTAAGTCATATGTAAAAGG - Intronic
992919321 5:81496953-81496975 CACATTAAGTATTTAATAAATGG - Intronic
993693544 5:91032925-91032947 CGCTTGAAGTCTGAAGTAAATGG - Intronic
993731435 5:91427758-91427780 ATAGTTAAGTCTTCAGTAAATGG + Intergenic
993847418 5:92961902-92961924 TTAATTAAGTCCTTAGTAAATGG - Intergenic
993917257 5:93758020-93758042 CTCATATAAACTTAAGTAAAGGG + Intronic
994513459 5:100738763-100738785 TTAAAGAAGTCTTAAGTAAATGG - Intergenic
996626507 5:125576260-125576282 CTCCTTAAGTCAGAAATAAAAGG - Intergenic
996779069 5:127164300-127164322 CTGATAATGTCTTAAGTAAAAGG + Intergenic
999043467 5:148442467-148442489 ATCATTAAGAATGAAGTAAATGG - Exonic
999714743 5:154351675-154351697 TTCATAAAGTCTAAAGTGAACGG - Intronic
1000489254 5:161889090-161889112 CACAGTAAGTGTTTAGTAAAGGG + Intronic
1001564898 5:172693627-172693649 CTCACTAAGACTTTGGTAAAGGG - Intergenic
1003442458 6:6155949-6155971 CTCATAAAACCTTAAATAAAGGG + Intronic
1003698890 6:8440417-8440439 CTCAATAAGTATTTATTAAATGG - Intergenic
1004012146 6:11700162-11700184 CTCATTATGTCTTTACTCAAGGG + Intergenic
1004074451 6:12332275-12332297 TTCATTCATTCTTAAGCAAACGG - Intergenic
1004802297 6:19163071-19163093 CTCATTAAGTCTTCTGTTATTGG - Intergenic
1004848921 6:19676449-19676471 TTCATTAGGTCTTATGTATAGGG + Intergenic
1005023468 6:21440028-21440050 CTCATTAAGTCCTATGTTAAGGG - Intergenic
1006398122 6:33800309-33800331 CCCCTGAAGTCTAAAGTAAAAGG + Intronic
1008291864 6:49725323-49725345 CTCATTCACTATTAAGTATAAGG + Intergenic
1008496800 6:52142415-52142437 CTCATTAATTGTCAAGTAATTGG + Intergenic
1009617615 6:66030991-66031013 CTCAGTGAGTCTTAGGTAAGTGG - Intergenic
1010754173 6:79647889-79647911 GTCATTAAGTCTAAAACAAAGGG - Intronic
1012013596 6:93825599-93825621 CTAAATAACTCATAAGTAAATGG - Intergenic
1012780666 6:103552932-103552954 TTCATAAAGTCTCAAGTAATTGG + Intergenic
1013190253 6:107797279-107797301 CTCAAGAAGTCTTAAGTAAATGG - Intronic
1013494060 6:110680136-110680158 CTTTTTAAGCCTAAAGTAAATGG - Intronic
1013707824 6:112859800-112859822 CTCATTAAGACATAAATAAATGG - Intergenic
1014566203 6:122951921-122951943 CTAAAGAAGTCTCAAGTAAATGG + Intergenic
1014768841 6:125438293-125438315 GTCATTAAGTATTGGGTAAAAGG - Intergenic
1015664811 6:135617037-135617059 CTCTTTGAGTCTGAACTAAATGG - Intergenic
1018601921 6:165553127-165553149 TTCATGAAGTTTTATGTAAAGGG - Intronic
1020732734 7:11904144-11904166 CTCATTCAGTCATTAGTAGATGG - Intergenic
1021471500 7:21007878-21007900 CTCATTAAGTATAATGTTAATGG - Intergenic
1022265442 7:28749222-28749244 CTAATTAACTCATAAGTAAATGG - Intronic
1022601532 7:31764873-31764895 TTCATTTATTCTTTAGTAAATGG - Intronic
1023604486 7:41916683-41916705 ATCATGAAGACTTAAGAAAAAGG - Intergenic
1030953504 7:115821816-115821838 CTCATAAAGTCTGAAGGGAAAGG + Intergenic
1031095898 7:117419731-117419753 TTCGTGAAGTCTTAAGAAAATGG + Intronic
1031620155 7:123925825-123925847 CTTATTAAGTCATAAGAGAATGG + Intronic
1031951044 7:127892498-127892520 CTCATAATGTCTTAAATACATGG + Intronic
1033454243 7:141488181-141488203 CTCATTAATTCTGAACCAAATGG + Intergenic
1034046426 7:147933553-147933575 ATCATTCAGCCTTAAGAAAAAGG + Intronic
1037024750 8:14021207-14021229 CTCATTGAAACTTAAGTAAATGG - Intergenic
1037059510 8:14489144-14489166 TTAATGAATTCTTAAGTAAAAGG - Intronic
1038574878 8:28696361-28696383 CTTATGGAGTCTTAAGTAAGGGG - Intronic
1040978992 8:53226158-53226180 CACATAAAATCTTAAGAAAATGG - Exonic
1041997537 8:64082448-64082470 CTCATTATGTGATAAGTTAATGG + Intergenic
1043410899 8:79994088-79994110 CTCATTAACACATTAGTAAACGG + Intronic
1044303622 8:90613157-90613179 CTCATTAACTTTTAAGTATTAGG + Intergenic
1044527150 8:93264976-93264998 TTCTTTAAGTGTTAAATAAAAGG - Intergenic
1044648106 8:94466358-94466380 CTCATTTACTGTTAAGAAAAAGG - Intronic
1046269382 8:111873757-111873779 CTCAGTAAGTCATCTGTAAATGG - Intergenic
1047556479 8:125937237-125937259 CTCCTTAAGTCTGAAGTAAGTGG + Intergenic
1048795692 8:138147312-138147334 AGCATTAAGTGTTAAGTAATGGG + Intronic
1050648044 9:7743317-7743339 CTCATTTACTCTTAATTAATTGG - Intergenic
1050733170 9:8733124-8733146 CTCATTAATTGTCAAGTTAATGG + Intronic
1050912339 9:11087396-11087418 TTCATCAAGTACTAAGTAAAGGG - Intergenic
1052548970 9:29922742-29922764 CATAGTAAGTCTTAAATAAATGG + Intergenic
1052941026 9:34132484-34132506 ATCATTATGTGTTAAGTAATTGG - Intergenic
1053344270 9:37366462-37366484 CACAGTTAGACTTAAGTAAATGG + Intergenic
1053392105 9:37743235-37743257 CTCATTAGGTATTCACTAAAAGG - Intronic
1053669780 9:40348284-40348306 ATAATGAATTCTTAAGTAAAAGG + Intergenic
1053919578 9:42974539-42974561 ATAATGAATTCTTAAGTAAAAGG + Intergenic
1054380911 9:64488285-64488307 ATAATGAATTCTTAAGTAAAAGG + Intergenic
1054514832 9:66028012-66028034 ATAATGAATTCTTAAGTAAAAGG - Intergenic
1054897087 9:70326362-70326384 CTCATGAAAACTTACGTAAATGG + Intronic
1055441600 9:76342152-76342174 TTCATTATGTTTAAAGTAAATGG + Intronic
1055725495 9:79223692-79223714 TTCATAAAGTATTAAGTAATTGG - Intergenic
1055928043 9:81531005-81531027 CTCATTAAATATGAATTAAATGG - Intergenic
1056633422 9:88312465-88312487 CTAAGTAAGTCTTCAGCAAAGGG + Intergenic
1061248056 9:129411541-129411563 CTCTTTATGTGTTAAGTAATGGG - Intergenic
1187497333 X:19806544-19806566 CTCAATAACTGTTAAGTAATTGG - Intronic
1190990845 X:55548813-55548835 CTCATGAAGTCTTCAGTACAAGG - Intergenic
1192032002 X:67523876-67523898 CTCATTAGGTTTTCAGTAAAGGG - Intergenic
1194697584 X:97073989-97074011 CTCATTTGGTCTTATGTATAAGG + Intronic
1194793454 X:98180148-98180170 CTCATGATCTATTAAGTAAAAGG + Intergenic
1196326480 X:114410801-114410823 GTCAAAAAGTCTTAAGTTAAAGG - Intergenic
1196891608 X:120296125-120296147 CTGATGAATTGTTAAGTAAAAGG - Intronic
1197328240 X:125120922-125120944 CTCATTATGGCATGAGTAAATGG + Intergenic
1198019526 X:132644528-132644550 CACATTAAGCCTCAAATAAATGG + Intronic
1198420599 X:136467940-136467962 CTCACAAAGTGTTAAGTCAAGGG + Intergenic
1198848485 X:140939507-140939529 CTCAATAAGTATTTACTAAATGG - Intergenic
1199286724 X:146062365-146062387 CTAATTATGTCTTAAATTAAGGG + Intergenic