ID: 992445296

View in Genome Browser
Species Human (GRCh38)
Location 5:76827895-76827917
Sequence ATGGTTAAAGAGTTCCTATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992445296 Original CRISPR ATGGTTAAAGAGTTCCTATA TGG (reversed) Intronic
905534533 1:38710051-38710073 CTGGTTAAAGAGTTCTTCAATGG + Intergenic
906467991 1:46101810-46101832 ATGGTTATAGAGTTTCTATATGG + Intronic
906911125 1:49952029-49952051 ATGGGTAAAGAGTTTCTGTTTGG + Intronic
907257895 1:53193762-53193784 ATGTTTTAAAAGTTCCTTTATGG + Intergenic
907353950 1:53856727-53856749 AAGCTTTAATAGTTCCTATATGG + Intronic
908697772 1:66864428-66864450 ATGTTTAAATAGTTGCTAAAAGG + Intronic
910865750 1:91786792-91786814 ATGGTTCAAAAGTTCCAAGATGG + Intronic
911835757 1:102616674-102616696 ATGGTTAAAAAGTTCAAAGAAGG + Intergenic
913313541 1:117529887-117529909 ATGGTTACAGAGTTTCTGTTTGG - Intergenic
917589935 1:176466172-176466194 AAGCTTAATGAGGTCCTATATGG + Intronic
921342965 1:214153007-214153029 ATGTTTAAACAGTTGCTCTAAGG + Intergenic
921374821 1:214462934-214462956 ATATTAAAAGAGTTCCTGTATGG - Intronic
923584795 1:235258602-235258624 AAGGGAAAAGAGTTCTTATAGGG + Intronic
923840697 1:237668564-237668586 GTCGTTAATGACTTCCTATATGG + Intronic
1064217412 10:13411936-13411958 ATGGGTACAGAGTTTCTATTTGG - Intergenic
1069015374 10:63423283-63423305 ATGGATGCAGAGTTCCTATTTGG - Intronic
1070117806 10:73545658-73545680 CTGGTTAAAGATTCCCTATAGGG + Exonic
1071304720 10:84288641-84288663 CTGGTTAAATAGTCTCTATAGGG - Intergenic
1075527067 10:123195792-123195814 ATGGGTACAGAGTTTCTGTAAGG - Intergenic
1079638658 11:22777053-22777075 ATGCATAAAAACTTCCTATATGG + Intronic
1080788419 11:35497448-35497470 ATGGTTACAGAGTTTCTGTTTGG + Intronic
1081797471 11:45831217-45831239 ATGGGTACAGAGTTTCTATTTGG + Intergenic
1085059517 11:73431897-73431919 ATGGTTACAGAGTTTCTGTTTGG - Intronic
1088176901 11:107063283-107063305 ATATTTAAAGAGTTCCTTTTGGG - Intergenic
1089506021 11:118962451-118962473 ATGGGTATAGAGTTTCTATTTGG - Intergenic
1093914120 12:24781555-24781577 ATGGTTCAAGAGATGCAATATGG - Intergenic
1095103178 12:38203564-38203586 AAGCTTAAAGAGTTCCTGGATGG - Intergenic
1097440968 12:59608252-59608274 ATGGGTAATGAGGACCTATATGG - Intronic
1097903800 12:64899695-64899717 ATGGAGAAAGAGTTCTTCTAAGG - Intergenic
1100629423 12:96372830-96372852 ATGTTGAAAGATTTCCTATGAGG + Intronic
1100780457 12:98020134-98020156 ATGAATAAAGAGTTCCTCTCAGG - Intergenic
1101142074 12:101806430-101806452 ATGGTTACAAAGTTCCTGTTTGG + Intronic
1101638332 12:106566174-106566196 ATGACTAAAGAGTGCCTATATGG + Intronic
1103732943 12:123040256-123040278 ATAGTTACAGAGTTTCTATTTGG + Intronic
1104509036 12:129359287-129359309 ATGGTTACAGAGTTTCTGTTTGG + Intronic
1104623016 12:130332429-130332451 ATTGTTAAAGAGTTAATATGTGG - Intergenic
1107241864 13:38245015-38245037 ATGGTTACAGAGTTTCTGTTTGG + Intergenic
1108780435 13:53824326-53824348 GAAGTTGAAGAGTTCCTATAAGG - Intergenic
1108945171 13:56013914-56013936 ATGGTTAAAGATTCCATACATGG + Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1110210325 13:72964358-72964380 ATGGGTACAGAGTTTCCATATGG + Intronic
1112758336 13:102665609-102665631 ATGGTTTAAGAGTTCATGGAAGG - Intronic
1114006892 14:18323634-18323656 ATGGGTACAGAGTTTCTATATGG + Intergenic
1115423475 14:33225385-33225407 TTGGTCAAAGAGTGCCTAAAAGG + Intronic
1118226745 14:63907845-63907867 GAGGTAAAAGAGTTGCTATATGG - Intronic
1118288125 14:64496010-64496032 ATGGTTGAATAGTTCCTATCAGG - Intronic
1118417070 14:65551500-65551522 ATGGTTAAAAATTTCCTAAGAGG + Intronic
1118542572 14:66844840-66844862 ATGGGTACAGAGTTTCTAAATGG - Intronic
1127319987 15:57834664-57834686 ATAGTTAAAGAGATCCTAAAGGG + Intergenic
1127419175 15:58788669-58788691 ATGGATTAAGATTTCCTATTTGG - Intronic
1131802538 15:96086088-96086110 ATGGGTGAAGACTTCATATATGG - Intergenic
1131950418 15:97675411-97675433 CTGGTTAAATAGTTCCTCTCTGG + Intergenic
1133654410 16:7846310-7846332 ATGTTTGAAGAGTTCTGATATGG + Intergenic
1133704971 16:8345648-8345670 ATGGGTAAATAGTTGCAATACGG - Intergenic
1134327656 16:13221748-13221770 ATGGTTATAGAGTTTCTTTCTGG - Intronic
1138089167 16:54160205-54160227 ATGGTTACAGAGTCTCTATTTGG - Intergenic
1140117149 16:72052018-72052040 ATGGGTACAGAGTTCCTGTTTGG - Intronic
1140438484 16:74968158-74968180 ATGGGTACAGAGCTCCTATTTGG + Intronic
1142543136 17:677487-677509 ATGTTTACAGAGTTTCTATTTGG + Intronic
1145186846 17:20802309-20802331 ATGGGTAAAGATTTTCAATAAGG - Intergenic
1145360844 17:22211107-22211129 ATGTTAAACCAGTTCCTATAAGG - Intergenic
1146851955 17:36229587-36229609 ATGGGTAAAGATTTTCAATAAGG + Intronic
1146867865 17:36353457-36353479 ATGGGTAAAGATTTTCAATAAGG + Intronic
1147070740 17:37954074-37954096 ATGGGTAAAGATTTTCAATAAGG + Intergenic
1147082266 17:38033600-38033622 ATGGGTAAAGATTTTCAATAAGG + Intronic
1147098210 17:38157564-38157586 ATGGGTAAAGATTTTCAATAAGG + Intergenic
1147981643 17:44278463-44278485 ATGGTTAGAGGGTACCTAAAAGG - Intergenic
1150034846 17:61783420-61783442 ATGGGTACAGAATTCCTATTTGG + Intronic
1150079748 17:62226573-62226595 ATGGGTAAAGATTTTCAATAAGG + Intergenic
1150685899 17:67320732-67320754 ATGGTTACAGAGTTCCTGTTTGG + Intergenic
1150890786 17:69146942-69146964 ATGGTTACAGAATTCCTGTTTGG - Intergenic
1153957605 18:10111389-10111411 ATGGTTACAGAGATTCTATTTGG + Intergenic
1154180361 18:12133039-12133061 ATGGGTACAGAGTTTCTATTAGG - Intergenic
1154530570 18:15340376-15340398 ATGGGTACAGAGCTTCTATATGG - Intergenic
1156578801 18:38351273-38351295 ATGGTAAAACAGTAACTATAAGG - Intergenic
1156605587 18:38663324-38663346 ATAATTAAAGTGTTCATATAAGG - Intergenic
925973851 2:9126953-9126975 ATGGATACAGAGTTTCTACATGG + Intergenic
926240056 2:11078547-11078569 ATGGGTACAGAGTTTCTATTTGG + Intergenic
926909724 2:17840960-17840982 ATGGTCTAAGATTTCCTTTATGG - Intergenic
928601813 2:32910832-32910854 ATGGCTAAAGAGTTTTCATACGG - Intergenic
930524772 2:52514381-52514403 AGGGTTAAAGAATTCTTATGTGG - Intergenic
935479574 2:103569216-103569238 ATGGTTACAGAGTTTCTGTTTGG + Intergenic
937407012 2:121639460-121639482 ATGGCTACAGAGTTTCTATTTGG + Intronic
938529675 2:132171844-132171866 ATGGGTACAGAGTTTCTATATGG - Intronic
939434233 2:142153239-142153261 ATGGGTAAAGGGTTTCTATTTGG - Intergenic
939915182 2:148032050-148032072 AAGTTTAAAGAGTTCTAATATGG + Intronic
940511263 2:154618084-154618106 AGGGTACAAGAGTTCATATAAGG + Intergenic
940937265 2:159510487-159510509 ATGGTTACAGAGTTTCTGTTTGG + Intronic
940977665 2:159964257-159964279 ATGGTTACAGAGTTTCTGTTTGG + Intronic
941819065 2:169827229-169827251 CTTATTAAAGATTTCCTATAAGG + Intergenic
942005163 2:171691321-171691343 ATGTCTAAAGAGTTTCCATAGGG - Intronic
943153270 2:184140962-184140984 ATATATAAAGAGTTTCTATATGG + Intergenic
945053131 2:205844331-205844353 ATGGTTACAGAGTTTCTTTTTGG + Intergenic
946590169 2:221237742-221237764 ATGGTTAAAGAGATCATGGAGGG - Intergenic
947013699 2:225593809-225593831 ATGGTCAAACATTTCTTATATGG - Intronic
948548785 2:238753442-238753464 ATGGTTTAAGAGTTGGTCTAAGG - Intergenic
1169025902 20:2371187-2371209 ATAGATAATGAGTTCCTTTAAGG + Intergenic
1171401776 20:24877852-24877874 ATGGTTACAGAGTTTCTATTTGG + Intergenic
1171479423 20:25442305-25442327 ATGGATAAAGATTCCTTATAAGG - Intronic
1175314333 20:58036853-58036875 ATAGCTAAAGAGTTACCATAAGG - Intergenic
1176274590 20:64256553-64256575 ATGGCTAAACAGCTCCTATCTGG + Intronic
1176766840 21:13028076-13028098 ATGGGTACAGAGCTTCTATATGG + Intergenic
1180431399 22:15254444-15254466 ATGGGTACAGAGTTTCTATATGG + Intergenic
1180566272 22:16668490-16668512 ATGGGTACAGAGTTTCTATTAGG + Intergenic
1182092962 22:27608613-27608635 ATGCTTTACCAGTTCCTATAGGG - Intergenic
1182665652 22:31957629-31957651 CTGGTTAAACAGTTCCTCGAGGG - Intergenic
1183240595 22:36655271-36655293 ATGGCAAAATAGTTTCTATAAGG + Intronic
1184621106 22:45678101-45678123 ATGTTTACAGAGTTTCTATTTGG + Intronic
949647762 3:6117439-6117461 ATGGGTAGGGAGTTCCTTTATGG + Intergenic
951044106 3:18019217-18019239 ACAGTTCAAGAGTTCCTAGATGG - Intronic
952409747 3:33036891-33036913 ATGGTTACAGAGTTTCTGTCTGG + Intronic
955043486 3:55338384-55338406 ATTAGTAAAGAGTTCCTTTAGGG + Intergenic
956158186 3:66320223-66320245 ATGGTTACAGAGTTTGTATCTGG - Intronic
956539839 3:70324080-70324102 CTGGTTAAACAGTCCCTGTAGGG - Intergenic
957187682 3:76964095-76964117 CTGTTTAACGAGTTCCTTTATGG - Intronic
957997279 3:87706463-87706485 ATGGTTAAAGTGTCACTCTAAGG - Intergenic
959044792 3:101462047-101462069 ATGGTTAAAGAGTTTCCATTTGG + Intronic
960959618 3:123061078-123061100 ATGGGTAAAGAGTTCCAGTATGG - Intergenic
961225291 3:125239130-125239152 ATGGGTACAGAGTTTCTATTCGG + Intronic
961813951 3:129538399-129538421 ATGCTTAAAGAGTTTCAAGAGGG + Intergenic
962523296 3:136216579-136216601 ATGGTCAAAGAGTAACTCTAAGG - Intergenic
962590844 3:136888656-136888678 GTGATTAAAGTGTTCCAATATGG - Intronic
963173154 3:142271469-142271491 ATGGGTACAGAGTTCCCATTGGG + Intergenic
966623870 3:181995593-181995615 ATGGTTAAAGAGTTGTGACATGG - Intergenic
968543667 4:1183340-1183362 ATGCTTAAGGAAGTCCTATAGGG + Intronic
970314148 4:14813340-14813362 ATAGGTAAAGAGTTCATATCTGG + Intergenic
970596639 4:17606214-17606236 AGGGTGAAAGAGTTCTTATGTGG - Intronic
971398195 4:26250106-26250128 ATGGGTACAGAGTTTCTATTTGG - Intronic
972070298 4:35011156-35011178 ATGGTTAAATAGGTCCTAAGTGG + Intergenic
972461778 4:39310807-39310829 ATTGTTTAAGAGTTCCTTAAAGG - Intronic
972522334 4:39871154-39871176 ATGGGTACAGAGTTTCTGTATGG + Intronic
974632257 4:64508226-64508248 ATGGGTACAGAGTTCTTATTAGG + Intergenic
977752797 4:100629827-100629849 ATTGTTAAAGCATTACTATAAGG + Intronic
978170242 4:105660955-105660977 ATGGGTACAGGGTTCCTTTAGGG - Intronic
979117427 4:116844038-116844060 ATGGCTATAGATTTCCTACAGGG + Intergenic
979792119 4:124797914-124797936 TTGGGTAGAGAGTTCCTAAAGGG - Intergenic
979988725 4:127348372-127348394 ATGTTTAAGAAGTTCTTATAAGG - Intergenic
980979823 4:139645003-139645025 ATGGTTATAGAGTTTCTGTTTGG - Intergenic
981360849 4:143844138-143844160 ATGGGTAATTAGTACCTATAAGG - Intergenic
981798381 4:148626447-148626469 ATATATAAAGAATTCCTATAAGG + Intergenic
983764896 4:171466871-171466893 ATGGTTACAGAGTTTCTATAGGG + Intergenic
986865999 5:11987943-11987965 AAGGTTATAGAGTTCCTGAAAGG - Intergenic
987168486 5:15226182-15226204 ATGGTTAAAGGGTTTCTGTTTGG - Intergenic
987295887 5:16550968-16550990 ATGGTTACAGAATTCCTTTTGGG + Intronic
987395081 5:17415582-17415604 ATGGTGAAAGGGTTCCTAACTGG - Intergenic
987908419 5:24108983-24109005 ATGGTTAATTAGGTCATATAAGG - Intronic
989368950 5:40685060-40685082 AGGGCTAAACAGTTACTATAGGG + Intronic
990223506 5:53622847-53622869 ATGGGTACAGAGTTTCTATTCGG - Intronic
991357408 5:65783167-65783189 ATGGTTACAGAGTTTCTGTTTGG + Intronic
992280177 5:75167045-75167067 ATGGTTAAAGGGTTTCTTTTAGG - Intronic
992445296 5:76827895-76827917 ATGGTTAAAGAGTTCCTATATGG - Intronic
992703991 5:79369450-79369472 ATGGGTACAGAGTTTCTATTTGG + Intergenic
993968929 5:94393140-94393162 ATGATTAATGAGTTCCTCTCCGG + Intronic
994307295 5:98222036-98222058 ATGGATAAAAAATTCCTTTAGGG + Intergenic
995110182 5:108420269-108420291 ATGGTTAATGAGCTCCTGTAAGG + Intergenic
995348249 5:111145634-111145656 ATGGGTTAAGTGTTCCTATTCGG + Intergenic
995751499 5:115457391-115457413 ATGTTTTATGAGTTTCTATAAGG + Intergenic
996090755 5:119349237-119349259 ATTGTTTAAGAGTGTCTATATGG - Intronic
996307978 5:122072715-122072737 ATGGTTAAAAAGAACATATATGG + Intronic
997826483 5:137111310-137111332 ATGACTAAAGAGTTGCTGTAGGG - Intronic
997827714 5:137122575-137122597 ATTGCTAAAGATTTCCTCTAAGG - Intronic
998062589 5:139130994-139131016 ATAGGTAAAGAGTTTCTATTTGG + Intronic
998493874 5:142570134-142570156 ATGGTTACACAGTTTCTATGTGG - Intergenic
998793455 5:145791599-145791621 ATGGCTAAGGAGTTCCTGTTTGG + Intronic
998989601 5:147801282-147801304 ATGTTTAACCGGTTCCTATAAGG + Intergenic
1001645291 5:173276980-173277002 ATGGGTACAGAGTTTCTATTTGG - Intergenic
1003295578 6:4823851-4823873 ATGGTTACAGAGTTTCTGTTTGG - Intronic
1004321085 6:14632009-14632031 ATGGGTACAGAGTTTCTATTGGG + Intergenic
1005379716 6:25220891-25220913 ATGGTTCAAAACTTCCTACAGGG - Intergenic
1006243701 6:32710029-32710051 ATGGTTACAGAGTTCCAGTTTGG - Intergenic
1007544570 6:42683090-42683112 AAGGTGAAAGAGATGCTATAAGG + Exonic
1008731367 6:54486455-54486477 ATGGTTAATGAGTTCAAATTGGG - Intergenic
1008833982 6:55803973-55803995 CTGGTTAAATAGTTCTTGTAAGG - Intronic
1011902037 6:92310942-92310964 AGGTTTAAACAGTTCTTATAGGG - Intergenic
1012028094 6:94024088-94024110 AAGGCTAAAGACTTCTTATATGG - Intergenic
1012720951 6:102743893-102743915 ATGGATAGAGAGTTCATAAAAGG + Intergenic
1013144516 6:107374729-107374751 ATGATTAAAGAGATAATATAAGG - Intronic
1013211236 6:107988794-107988816 TTGGTTAAAGAGTTTATCTAAGG - Intergenic
1014354607 6:120390246-120390268 ATGGTTAATGATATCCTACATGG + Intergenic
1014746594 6:125208259-125208281 ATGGATAAAGAATTGCTATCAGG - Intronic
1015935136 6:138401624-138401646 AAGGTTATAGAGTTTCTTTAAGG + Intergenic
1019879746 7:3848329-3848351 ATGCTTGGAGAGTTCCGATAAGG - Intronic
1020975646 7:15003000-15003022 ATATTTAAAGAGTTCTTGTAGGG + Intergenic
1021197940 7:17693239-17693261 ATGGTTAAAGGGTTTCTCTCAGG - Intergenic
1022857658 7:34331372-34331394 ATGGTTACAGAGTTCATCTGAGG - Intergenic
1023240696 7:38143873-38143895 ATGGTTACAGAGTTTCTATTTGG + Intergenic
1023481216 7:40636650-40636672 ATGGGTACAGAGTTTCTATTTGG + Intronic
1026995818 7:74615477-74615499 ATGGGTAAAGAGTTTCTGTTTGG + Intergenic
1027403947 7:77838610-77838632 TTGGTTACAAAGATCCTATAAGG + Intronic
1029351946 7:100019593-100019615 ATGGTTAAAGAGTTTACATTGGG + Intronic
1034603972 7:152293429-152293451 ATGGTTCAAAAGTTCCTAAAGGG + Intronic
1039184533 8:34901944-34901966 ATGGTTAGCTAGTTGCTATATGG + Intergenic
1041731104 8:61063844-61063866 ATGGGTACAGAGTTCCTACTAGG - Intronic
1042356341 8:67832509-67832531 ATAGTTAGAGACTTCATATAGGG + Intergenic
1042724333 8:71856744-71856766 ATGGCTGAAAAGTTCCCATATGG - Intronic
1042730861 8:71933087-71933109 ATGGTTACAGAGTTTCTCTTTGG + Intronic
1043047444 8:75344512-75344534 AGTGTTAAAGAGTTTGTATATGG + Intergenic
1043282983 8:78491836-78491858 ATGGGTATAGAGTTGCTATGTGG + Intergenic
1043671319 8:82888208-82888230 ATGGGTACAGAGTTTCTATTTGG + Intergenic
1045268014 8:100637055-100637077 CTGGTTACAGAATTCCAATAAGG + Intronic
1045634969 8:104174245-104174267 ATGGTTAAAATGATCCTTTAGGG - Intronic
1047244037 8:123122559-123122581 ATGGATACAGAGTTTCTATTTGG + Intronic
1047844200 8:128788435-128788457 CTGGTGAAGGAGTTTCTATAAGG + Intergenic
1047864014 8:129001667-129001689 ATGATTACAGAGTTTCTATTTGG + Intergenic
1048749710 8:137658413-137658435 ATGCTTCAAGAATTCATATAAGG + Intergenic
1050122735 9:2324713-2324735 AAGGTTATAGAGTTACTGTATGG + Intergenic
1051443943 9:17120395-17120417 ATGGATAGAGAGTTTCTATTTGG + Intergenic
1052041968 9:23749006-23749028 ATGGTTACAGAGTTTCTATCTGG + Intronic
1053708275 9:40778112-40778134 ATGGGTACAGAGCTTCTATATGG - Intergenic
1053721501 9:40951432-40951454 ATGGGCACAGAGTTCCTATCTGG - Intergenic
1053831545 9:42087230-42087252 ATGGATAACATGTTCCTATATGG - Intronic
1054418184 9:64898902-64898924 ATGGGTACAGAGCTTCTATATGG - Intergenic
1054599000 9:67100218-67100240 ATGGATAACATGTTCCTATATGG + Intergenic
1056420149 9:86416603-86416625 ATGGGTATAGAGTTTCTATTTGG + Intergenic
1056994893 9:91446576-91446598 ATGGTTACAGAGTTTCCATTTGG - Intergenic
1058166870 9:101629508-101629530 AGGTTTTAAGAGTTCCTATATGG - Intronic
1059830915 9:118094875-118094897 CTGGTTAAACAGTTTCTATAAGG + Intergenic
1060640973 9:125238682-125238704 CTGGTTAAAGAGTTCTTCAATGG - Exonic
1186946177 X:14570120-14570142 ATGGTTACAGAGTTGTTATTTGG + Intronic
1187413132 X:19068487-19068509 ATGGATATAGAGTTTCTATTTGG + Intronic
1188304587 X:28546900-28546922 ATGGTTACAGAGTTTCTTTTTGG - Intergenic
1189937271 X:46082630-46082652 ATGATCACAGTGTTCCTATATGG - Intergenic
1191038902 X:56057726-56057748 AAGGTTCAATAGTTCCTCTAGGG + Intergenic
1192711471 X:73594718-73594740 ATGGCTATAGAGTTCCTATTTGG - Intronic
1193104845 X:77659081-77659103 ATGGTTAAAGAGATTCCATTTGG + Intronic
1194061114 X:89199393-89199415 ATGGGTAAAGAGTTTCTTTTTGG - Intergenic
1194670527 X:96727071-96727093 ATAAATAAAGAGTACCTATACGG - Intronic
1195490566 X:105464327-105464349 GTGGTTAAATAGTTTCCATAAGG + Intronic
1199740203 X:150728466-150728488 ATGGTCAGAGACTTCCTAAAGGG + Intronic
1200438614 Y:3184866-3184888 TTGTCTATAGAGTTCCTATACGG - Intergenic
1201886384 Y:18887729-18887751 ATGTTAAAAGAGGCCCTATAGGG - Intergenic