ID: 992450862

View in Genome Browser
Species Human (GRCh38)
Location 5:76874600-76874622
Sequence AAGCATTTATACGTGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992450862_992450870 28 Left 992450862 5:76874600-76874622 CCCTCCCCCACGTATAAATGCTT 0: 1
1: 0
2: 0
3: 12
4: 134
Right 992450870 5:76874651-76874673 GAGCTGTGTATCTGTTGAACAGG 0: 1
1: 0
2: 0
3: 8
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992450862 Original CRISPR AAGCATTTATACGTGGGGGA GGG (reversed) Intronic
902789410 1:18756473-18756495 AAGCTTTTATTCATGGCGGAAGG - Intergenic
904778571 1:32927119-32927141 AAGCTTTTATTCATGGTGGAAGG + Intergenic
905096505 1:35476290-35476312 AAACATTTTTAGTTGGGGGAGGG - Intronic
905771412 1:40640341-40640363 AAGCTATTATAGGTGGGGAAGGG - Intronic
906207902 1:43996843-43996865 AAGCATTTGTTTCTGGGGGATGG - Intronic
915118872 1:153616344-153616366 CAGCTCTTATACCTGGGGGAAGG + Exonic
918884459 1:190173295-190173317 AAGAATCTGTACGTGGGGGAAGG + Intronic
922652430 1:227352788-227352810 AAGCAGTTATGCATGAGGGAGGG - Intergenic
1063336115 10:5216094-5216116 AAGCATTTACTCGTGGTAGAAGG + Intronic
1063454466 10:6173516-6173538 GAGCATATATAGGTGGGGGAAGG - Intronic
1066746663 10:38608175-38608197 AAGCATTCACTGGTGGGGGAGGG + Intergenic
1067012425 10:42726969-42726991 AAGCTTTTACTCGTGGTGGAAGG - Intergenic
1068031030 10:51705176-51705198 AAAGATTTAAACATGGGGGAGGG - Intronic
1070535579 10:77374879-77374901 AAGTATCTATATTTGGGGGAAGG + Intronic
1071143165 10:82536475-82536497 AAGAACTTATATGTGGGGGATGG + Intronic
1072233056 10:93429256-93429278 AAGCTTTTACTCGTGGGGGAAGG - Intronic
1075436756 10:122450229-122450251 AACCATTAATACTGGGGGGATGG - Intergenic
1077271094 11:1681631-1681653 AATCATTTAAACCTGGGGGTTGG + Intergenic
1078875602 11:15392432-15392454 AAGAATTTATACCTAGGTGAGGG + Intergenic
1082614836 11:55346990-55347012 AAACATGTATACATTGGGGAAGG + Intergenic
1086238300 11:84658735-84658757 AAGCTTTTAATCGTGGTGGAAGG - Intronic
1089942686 11:122435986-122436008 AATCATTTATTGGTGGGGGAAGG - Intergenic
1091001428 11:131913077-131913099 AATCATTTCTGAGTGGGGGAAGG - Intronic
1091167627 11:133493432-133493454 ATGCATGTACACATGGGGGAAGG - Intronic
1097455575 12:59795535-59795557 AAGAATATATACGTGCGGGAGGG + Intergenic
1098286673 12:68914039-68914061 TAGCATTTATACCTGAGGAATGG - Intronic
1102558539 12:113745840-113745862 ACTCATTTATAACTGGGGGAAGG + Intergenic
1104691868 12:130832653-130832675 GAGCATTTAAACTTGGGGGCGGG + Intronic
1106344851 13:28866036-28866058 AAGTATTCATACTTGGGGGAGGG + Intronic
1109156759 13:58921089-58921111 AAGGATATATACTTTGGGGAAGG + Intergenic
1110277501 13:73656695-73656717 AATGATTTACACGTAGGGGATGG + Intergenic
1110461907 13:75754510-75754532 TAGGATATATACCTGGGGGAAGG + Intronic
1113273338 13:108700040-108700062 AAGCATTTATAGGCTGGGCATGG + Intronic
1114165681 14:20216322-20216344 AAGCACTTCTAAGTGTGGGAGGG - Intergenic
1118084977 14:62404244-62404266 AAGCTTTTATTCATGGTGGAAGG - Intergenic
1118690299 14:68332222-68332244 AGCCATTTATATTTGGGGGATGG - Intronic
1119845183 14:77823983-77824005 AAGCACTTAAACCTGGGAGATGG - Intronic
1123894667 15:24816620-24816642 AAGCTTGTACTCGTGGGGGAAGG - Intergenic
1128945802 15:71819808-71819830 AAGCCCTTAGAAGTGGGGGAGGG - Intergenic
1130287901 15:82570972-82570994 AAACACTTTTAGGTGGGGGAGGG - Intronic
1132200220 15:99947952-99947974 AAGCATTTATACCTTAGAGAAGG - Intergenic
1132785378 16:1654296-1654318 AATCACTTAAACGTGGGAGACGG - Intronic
1133447540 16:5874939-5874961 ATGCATTTATTTATGGGGGACGG - Intergenic
1133528565 16:6630958-6630980 ATGCATTTAGATTTGGGGGAGGG + Intronic
1136736399 16:32471458-32471480 AAGCATTCACTGGTGGGGGAGGG - Intergenic
1139542468 16:67628536-67628558 AAACATTTACACGTCGGGTAAGG + Exonic
1141330689 16:83108290-83108312 AAACATTTACAGGTGGGGCATGG - Intronic
1203016671 16_KI270728v1_random:358120-358142 AAGCATTCACTGGTGGGGGAGGG + Intergenic
1203035006 16_KI270728v1_random:631278-631300 AAGCATTCACTGGTGGGGGAGGG + Intergenic
1145946039 17:28775329-28775351 AGGCATTTTTCCGTGGGGAATGG + Intronic
1147258689 17:39196704-39196726 AAGCTGTTTTACCTGGGGGAGGG - Intronic
1149214541 17:54338612-54338634 ATCTATTTATACGTGAGGGAAGG + Intergenic
1151339655 17:73462654-73462676 ACGCATGTATATGTGGTGGAAGG + Intronic
1151709762 17:75796958-75796980 TAGGAGTTATATGTGGGGGAAGG + Intronic
1159330249 18:66984848-66984870 AAACATTAATACTTGGGGAATGG - Intergenic
1159500547 18:69263788-69263810 GAGCATATATAGGTGGGGGGAGG - Intergenic
1159782487 18:72675976-72675998 AAGTAATTATACGTGTGGGTTGG - Intergenic
925932891 2:8724333-8724355 AAGCACTTGAACGTGGGAGACGG - Intergenic
925942214 2:8831452-8831474 AGGCATATATACGTGGAGAATGG - Intronic
926516957 2:13859050-13859072 AAGCATTTATAAGAAGGGAAAGG - Intergenic
929207970 2:39319891-39319913 AAACATTTAGATATGGGGGATGG + Intronic
932126504 2:69149898-69149920 CAACATTTATACATGGGTGATGG - Intronic
932263631 2:70347286-70347308 AAGAATTTATATGTGTGTGAAGG + Intergenic
933044442 2:77518273-77518295 AAGCATTTCTACTGCGGGGAAGG - Intronic
934309070 2:91847364-91847386 AAGCATTCACTGGTGGGGGAGGG + Intergenic
935523480 2:104138238-104138260 AAGCTTTTATTCATGGTGGAAGG - Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
936977610 2:118235230-118235252 AAGCATTTAATCATGGTGGAAGG - Intergenic
940465828 2:154025309-154025331 AAACATTTAAACATGGGGGGAGG - Intronic
942475227 2:176312377-176312399 AACCATATATTCTTGGGGGATGG + Intronic
942517098 2:176765909-176765931 AAATATTTATTGGTGGGGGAGGG - Intergenic
946132869 2:217621351-217621373 TAGCATGAATACGTGGGTGAAGG + Intronic
947197365 2:227582379-227582401 AAGCTTTTATCCATGGTGGAAGG - Intergenic
1170211031 20:13846425-13846447 AATCATTTAAACCTGGGAGACGG + Intergenic
1172798117 20:37557272-37557294 AAGCACTCCTAAGTGGGGGAGGG + Intergenic
1174845746 20:53941579-53941601 AAGAATTAAGACCTGGGGGAGGG - Intronic
1179458197 21:41514168-41514190 AAGTATTTATCTGTGGAGGATGG + Intronic
1180032602 21:45222658-45222680 AAGCATCTATATATGGAGGAGGG + Exonic
1180536148 22:16394462-16394484 AAGCATTAACTGGTGGGGGAGGG + Intergenic
1182166405 22:28178619-28178641 AGGCATTTATACCTGGGAGCAGG + Intronic
1182387807 22:29961179-29961201 AAGCATATAAATTTGGGGGAAGG - Intronic
1183779018 22:39986747-39986769 AATCACTTAAACCTGGGGGATGG + Intergenic
1184954344 22:47873741-47873763 AGGCATTTAGATGTTGGGGATGG - Intergenic
952500994 3:33961866-33961888 AAGCTTTTATTCATGGCGGAAGG + Intergenic
954251979 3:49374968-49374990 AATCCTTTAAACCTGGGGGAAGG + Intronic
956612782 3:71141418-71141440 AAGCTCTTAAAAGTGGGGGAGGG - Intronic
961473025 3:127129477-127129499 ACTCATTTATAAGTGAGGGAGGG + Intergenic
961929390 3:130517143-130517165 AAGCGTTTATATGTCGGCGAGGG + Intergenic
966181735 3:177195301-177195323 TAGCATTTACCTGTGGGGGAGGG - Intronic
970882776 4:20951135-20951157 ATGCATGTATAGGTGGGGCAGGG - Intronic
971313903 4:25551224-25551246 AATCATTTAAACCTGGGAGACGG - Intergenic
972066975 4:34959508-34959530 AAGCATTTATAAGTTAGGAATGG + Intergenic
975603170 4:76125202-76125224 AATCACTTAAACCTGGGGGATGG + Intronic
978283367 4:107044213-107044235 AAATCTTTATATGTGGGGGATGG + Intronic
978322450 4:107512987-107513009 AAGTATTTATATGTAGGGCAAGG + Intergenic
980062018 4:128141338-128141360 AAACATTTATAGTTAGGGGAAGG - Intronic
983848409 4:172547462-172547484 AAGAATATATAGCTGGGGGAGGG + Intronic
984660834 4:182373449-182373471 AAGCTTTTACTCGTGGAGGACGG + Intronic
985994337 5:3588635-3588657 AAGGATTTATATGTGTGTGATGG - Intergenic
987183605 5:15391422-15391444 TTGCATTTAGAAGTGGGGGATGG + Intergenic
987527060 5:19065702-19065724 AAGCATTTATACTTGATTGATGG + Intergenic
992450862 5:76874600-76874622 AAGCATTTATACGTGGGGGAGGG - Intronic
994991715 5:107004959-107004981 AAGCATATTTAATTGGGGGAGGG - Intergenic
995028785 5:107455964-107455986 AAGCATTTCTAGGTAGTGGATGG - Intronic
995202316 5:109440005-109440027 AAGCATTTATAAGTGGGCTTAGG + Intergenic
996774991 5:127123018-127123040 CTACTTTTATACGTGGGGGAGGG + Intergenic
999659357 5:153842772-153842794 AAGCTTTTACTCATGGGGGAAGG - Intergenic
1001012375 5:168109998-168110020 AAGCAATTTAACTTGGGGGAGGG - Intronic
1006382461 6:33707771-33707793 AAGAATTGCAACGTGGGGGAAGG - Intronic
1009329158 6:62394091-62394113 AATCATTTATATGTAGGGTATGG + Intergenic
1010130475 6:72486774-72486796 TAGCATTTATACGTAGGAGAGGG + Intergenic
1012178933 6:96126265-96126287 AAGCTTTTATTCATGGAGGAAGG + Intronic
1013111130 6:107066140-107066162 AAGAATTTAGATGTGGGGGAAGG + Exonic
1014822505 6:126007104-126007126 AAGCATTTATGTGAGAGGGAAGG - Intronic
1017797366 6:157858135-157858157 AAGCACTTATACATGGGGTGGGG - Intronic
1017799828 6:157884594-157884616 AAGAATTCATACGGGGGGGTGGG - Intronic
1022309398 7:29181878-29181900 AAGTATTTATTCATGGTGGAGGG + Intronic
1024319386 7:48049965-48049987 AAGCACTTACACGGGGGGGAAGG - Exonic
1025728748 7:64091350-64091372 AAGTATTTATACAAAGGGGAGGG + Intronic
1026226217 7:68443790-68443812 AAGCTTTTATTCATGGAGGAAGG - Intergenic
1026620405 7:71945177-71945199 AAGCTTTTATTCATGGTGGAAGG - Intronic
1027949732 7:84799604-84799626 AAGCTTTTATTCATGGTGGAAGG - Intergenic
1033080378 7:138290993-138291015 AAGCATTTTTAGGTTGGGCATGG - Intergenic
1033196208 7:139329648-139329670 GAGCATTCTTACGTGGGTGATGG + Intergenic
1034776921 7:153836329-153836351 GAGCATTTGTACGTGGGGTGGGG + Intergenic
1040996465 8:53407639-53407661 AAGCCTTTACTCATGGGGGAAGG - Intergenic
1041732280 8:61074976-61074998 AAGCATTTAAAAGGGGGGGGAGG - Intronic
1042227415 8:66524911-66524933 AGGCATTTTTGCCTGGGGGATGG - Intergenic
1042611366 8:70605136-70605158 AAGCATTTTTATGTGAGAGAAGG - Intronic
1044301718 8:90591851-90591873 ACTCATTTAAACTTGGGGGAAGG + Intergenic
1045004351 8:97904499-97904521 AAACATTGAGACCTGGGGGATGG + Intronic
1045440706 8:102207018-102207040 AACCATTTATACATAGAGGAAGG - Exonic
1045821975 8:106349418-106349440 AAGGATTTGAACTTGGGGGATGG + Intronic
1046287319 8:112110924-112110946 AAGCTTTTATTCATGGTGGAAGG + Intergenic
1047885852 8:129249264-129249286 AAGCTTTTATTCATGGAGGAAGG - Intergenic
1048515439 8:135105115-135105137 AAGGATAAATACTTGGGGGATGG - Intergenic
1062163794 9:135095392-135095414 GAGAATTTATACCTGGGGGCGGG + Intronic
1189755731 X:44269635-44269657 AAGCTTTTACTCGTGGTGGAAGG - Intronic
1193632892 X:83911627-83911649 AAGCTTTTATTCATGGTGGAAGG + Intergenic
1193704246 X:84801738-84801760 AAGCTTTTACTCATGGGGGAAGG - Intergenic
1194160364 X:90441941-90441963 AAGCACTTATAAGAGTGGGAAGG - Intergenic
1195734625 X:107999919-107999941 AAGCTTTTATTCATGGTGGAAGG - Intergenic
1196374930 X:115023253-115023275 AGGCATTTATACATGTTGGATGG - Intergenic
1196384956 X:115139671-115139693 AAGCCTGTATACTTGGGGGAGGG + Intronic
1198699670 X:139383125-139383147 GAGCATGTATAAGTGGGGGTTGG - Intergenic
1199161302 X:144615100-144615122 AAGCTTTTATTCGTGGCAGAAGG - Intergenic
1200506655 Y:4018889-4018911 AAGCACTTATAAGAGTGGGAAGG - Intergenic