ID: 992456598

View in Genome Browser
Species Human (GRCh38)
Location 5:76922162-76922184
Sequence CTCCACCCCCTCCCAAGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992456591_992456598 23 Left 992456591 5:76922116-76922138 CCTTAGAAGCTGCCTCAGAATCA No data
Right 992456598 5:76922162-76922184 CTCCACCCCCTCCCAAGCATAGG No data
992456595_992456598 -6 Left 992456595 5:76922145-76922167 CCCTAACCTTGTCTTGTCTCCAC No data
Right 992456598 5:76922162-76922184 CTCCACCCCCTCCCAAGCATAGG No data
992456593_992456598 11 Left 992456593 5:76922128-76922150 CCTCAGAATCAAGGTTCCCCTAA No data
Right 992456598 5:76922162-76922184 CTCCACCCCCTCCCAAGCATAGG No data
992456594_992456598 -5 Left 992456594 5:76922144-76922166 CCCCTAACCTTGTCTTGTCTCCA No data
Right 992456598 5:76922162-76922184 CTCCACCCCCTCCCAAGCATAGG No data
992456596_992456598 -7 Left 992456596 5:76922146-76922168 CCTAACCTTGTCTTGTCTCCACC No data
Right 992456598 5:76922162-76922184 CTCCACCCCCTCCCAAGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992456598 Original CRISPR CTCCACCCCCTCCCAAGCAT AGG Intergenic
No off target data available for this crispr