ID: 992462342

View in Genome Browser
Species Human (GRCh38)
Location 5:76972884-76972906
Sequence TATCACAGAAAGAATGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 233}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992462339_992462342 13 Left 992462339 5:76972848-76972870 CCTCTCTTACAGTTAGGCTTGGT 0: 1
1: 0
2: 0
3: 10
4: 123
Right 992462342 5:76972884-76972906 TATCACAGAAAGAATGTGGGTGG 0: 1
1: 0
2: 0
3: 23
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992462342 Original CRISPR TATCACAGAAAGAATGTGGG TGG Intronic
901926916 1:12571828-12571850 TATTACAGAAACAATGTGGCCGG - Intronic
904312764 1:29640053-29640075 TATTCCAGAAAGGATGTGAGGGG - Intergenic
904916683 1:33975570-33975592 TATTACAGAAGGAATCTGGGTGG - Intronic
904979541 1:34485731-34485753 TATAAAAGAAAGAAAGTGGATGG + Intergenic
906464135 1:46060999-46061021 TTACACAGAAAGGATGTGGCAGG - Intronic
911430989 1:97786843-97786865 TATACCTGAAAGAATTTGGGTGG + Intronic
911971395 1:104442213-104442235 CATCACAGAAAGAAGTTGGAAGG + Intergenic
916088076 1:161285635-161285657 CAACACAGAGACAATGTGGGTGG - Intergenic
916282441 1:163066825-163066847 TATCAGAGAAAGAAGGTGGAAGG + Intergenic
916974949 1:170066179-170066201 TATAACATAAAGAATGGGGGGGG - Intronic
917223623 1:172758504-172758526 AATTACAGAAAGAAAGTGGGAGG - Intergenic
918275115 1:182946366-182946388 TACCACAGAAAGAGCCTGGGTGG - Intronic
923621988 1:235587192-235587214 TGTGACAGAAAGTATGTGTGAGG + Intronic
924745444 1:246829235-246829257 AGTCACAGAAAGAATGGGAGGGG - Intergenic
1062851022 10:743477-743499 GATACCATAAAGAATGTGGGCGG + Intergenic
1066035389 10:31476596-31476618 TATCACAGAAAGAGTTAGGGAGG - Intronic
1068864239 10:61878252-61878274 TATTAAAGAAAAAATCTGGGCGG + Intergenic
1070395732 10:76009992-76010014 TATAACAGAGAGAAGGCGGGTGG - Intronic
1070812775 10:79306611-79306633 TATCACAGAAAAAATACAGGAGG - Intronic
1072453390 10:95556934-95556956 TAATAAAGAAAGAATGAGGGAGG + Intronic
1074258266 10:111826035-111826057 TATCACTGAAAGAAGGTAGTGGG - Intergenic
1075387127 10:122062982-122063004 TCACACAGACAGAATGTGGCAGG + Intronic
1075467735 10:122664181-122664203 CATCCCACAAAGAATGTGGATGG - Intergenic
1077564731 11:3290350-3290372 CATTACAGAAAGATGGTGGGGGG + Intergenic
1077570620 11:3336167-3336189 CATTACAGAAAGATGGTGGGGGG + Intergenic
1078024695 11:7683675-7683697 TATCAGAGAAGGTAGGTGGGAGG - Intergenic
1079054954 11:17197571-17197593 TATCACTGTATGTATGTGGGAGG + Intronic
1081147509 11:39581207-39581229 TATCACAAACAGAATGTGCAAGG - Intergenic
1081403215 11:42666607-42666629 GCTCACAGAGAGAATCTGGGAGG - Intergenic
1082304769 11:50558415-50558437 TATCACAGAAAAAAACTGGTAGG - Intergenic
1082890673 11:58135369-58135391 GAACACAGACAGCATGTGGGTGG + Intronic
1083649404 11:64192668-64192690 CCTCACAGGAAGAAGGTGGGCGG - Intronic
1083965977 11:66043967-66043989 CATCATAGAAAGACTGTGGCTGG + Intronic
1085951430 11:81337127-81337149 TACAACAGAAAGAATCTTGGAGG + Intergenic
1086178245 11:83918413-83918435 TACCACAGGAAGAATGGGGATGG - Intronic
1086657517 11:89378139-89378161 TAGGACAGAAAGAATATGGGTGG - Intronic
1086858331 11:91894325-91894347 TATCACTGAAACATTCTGGGGGG + Intergenic
1087335351 11:96837330-96837352 TCTATCAAAAAGAATGTGGGTGG + Intergenic
1087335924 11:96844677-96844699 TATCTTAGTAAGAATGAGGGAGG + Intergenic
1088785259 11:113175912-113175934 AATCACGGTAAGAATGTGGGTGG + Intronic
1091807684 12:3367455-3367477 CATGAGAGAAACAATGTGGGAGG + Intergenic
1092060657 12:5547815-5547837 GATCACAGGAAGGATGAGGGGGG + Intronic
1092292972 12:7175169-7175191 TGTTACAGAAATATTGTGGGAGG + Intergenic
1092847642 12:12598750-12598772 TGTGACAGAAAGAATCTGGAAGG + Intergenic
1092947337 12:13468987-13469009 GATCAAAGCAAGAATGTGGAGGG + Intergenic
1093674959 12:21927921-21927943 AATCAAAGAAAGAATCTGGCTGG + Intronic
1093695951 12:22160648-22160670 TTTCACAGAAAAAGTGTGGGTGG + Intronic
1095389772 12:41692075-41692097 TATCACAAGAACACTGTGGGGGG - Intergenic
1095409947 12:41910715-41910737 TAGCACAAAAAGAAAGTGGGTGG - Intergenic
1097544410 12:60980856-60980878 ATTCACAGAAACAAAGTGGGAGG - Intergenic
1099505000 12:83463218-83463240 GCTCACAGATTGAATGTGGGTGG + Intergenic
1100078667 12:90821969-90821991 TATAAAAGAAAGAATGTGCCAGG - Intergenic
1101554109 12:105791121-105791143 TACCTTAGACAGAATGTGGGAGG - Intergenic
1101826422 12:108223972-108223994 TCTCAGAGAAAGAAAGCGGGAGG - Intronic
1103492557 12:121333885-121333907 TATCATATAAGTAATGTGGGAGG - Intronic
1106263739 13:28091519-28091541 TACCACAGGAAGAAAATGGGGGG - Intronic
1106650676 13:31686925-31686947 TATAACTGAAAGATTGAGGGAGG - Intergenic
1106663522 13:31827151-31827173 TATTACAGAAAGAAGCTGGGTGG + Intergenic
1108390127 13:49938738-49938760 TATAAGAGAAAGAATTTGAGAGG - Intergenic
1109360342 13:61286987-61287009 GATAATAGAATGAATGTGGGAGG + Intergenic
1109513645 13:63412474-63412496 TATCAAAGAAATAATTTTGGAGG - Intergenic
1110237749 13:73234162-73234184 ATTCACAGAAAGGATGTGGGAGG - Intergenic
1110875206 13:80501093-80501115 TATTAAAGAAAGAATCTTGGAGG - Intergenic
1112168361 13:96944193-96944215 TAGCACACATGGAATGTGGGAGG - Intergenic
1116520151 14:45836606-45836628 TAGCAAAAAAAAAATGTGGGTGG - Intergenic
1117067674 14:52026629-52026651 TAACTTAGAAAGAATGTGTGAGG - Intronic
1118326902 14:64787261-64787283 TATCATACAAAGTCTGTGGGGGG - Intronic
1118524815 14:66627375-66627397 TATCTGAGAAACAATGTTGGGGG - Intronic
1119490260 14:75025974-75025996 TATCTGAGACAGAATTTGGGAGG - Intronic
1124221563 15:27854130-27854152 TTTGACCGATAGAATGTGGGTGG + Intronic
1125711243 15:41788528-41788550 GATCACAGAAAGAATCAGAGGGG + Intronic
1126076032 15:44910781-44910803 GAACACAGAAAGAATGGGAGTGG + Intergenic
1126473459 15:49041759-49041781 TAACATAGAAAGAATATGGAGGG - Intronic
1128432963 15:67617239-67617261 AATTAAAGAAAGAATGGGGGAGG - Intronic
1133484192 16:6202745-6202767 AATTACATAAAGAACGTGGGAGG - Intronic
1135882551 16:26272649-26272671 TAACACAGAAAGAAGAAGGGTGG - Intergenic
1135914711 16:26595522-26595544 TCTCAAAAAAAGAAAGTGGGGGG - Intergenic
1135982903 16:27162479-27162501 TGCCACAGAAAGAATGCTGGAGG + Intergenic
1137408584 16:48209077-48209099 TATGACAGACAGAAAGTTGGGGG + Intronic
1138483309 16:57318461-57318483 TAACACAGAAAGAATTTGCATGG + Intergenic
1138501664 16:57449076-57449098 TTTCAAAGAAAAAATGAGGGAGG + Intronic
1139320169 16:66107863-66107885 TGTCACACAAAGTATGTGTGTGG - Intergenic
1139596281 16:67960152-67960174 CATCTCAGCAGGAATGTGGGAGG - Intronic
1140578761 16:76203536-76203558 TATCATAAGAAGAATGTAGGAGG - Intergenic
1142551167 17:740793-740815 AATGGCAGAAAGAGTGTGGGAGG + Intronic
1143677232 17:8443273-8443295 TATCAGTGAAAGCATGTGTGGGG + Intronic
1144887000 17:18470110-18470132 TACCACATAAAAAAGGTGGGGGG - Intergenic
1145145216 17:20474185-20474207 TACCACATAAAAAAGGTGGGGGG + Intergenic
1145842834 17:28010542-28010564 GATTCCAGAATGAATGTGGGAGG + Intergenic
1148121175 17:45212769-45212791 TATCACAATCAGAATCTGGGGGG - Intergenic
1148195134 17:45707768-45707790 GATGACAGCAAGAATGAGGGGGG - Intergenic
1151260780 17:72914440-72914462 GATGACTGAAAGAATATGGGAGG + Intronic
1153112263 18:1605962-1605984 TTTCACAGAAAAAATGAGGAAGG - Intergenic
1156553779 18:38044933-38044955 GATTACAGAAAGAAAGAGGGAGG + Intergenic
1157247155 18:46064641-46064663 AAACACAGTGAGAATGTGGGAGG + Intronic
1157698881 18:49746853-49746875 GAAAACAGAATGAATGTGGGTGG - Intergenic
1160073101 18:75645472-75645494 TATCCAAAAATGAATGTGGGAGG + Intergenic
1166904779 19:46100534-46100556 TAACACAAACAGAATGTGGTAGG + Intergenic
1168132060 19:54327670-54327692 TATCCAAGAAAGAACATGGGAGG - Intergenic
1168367325 19:55799697-55799719 TATGTCAGAAAGAAAGTGAGGGG + Intronic
925093341 2:1172920-1172942 TATCACAGCAGGAAAGTGAGAGG + Intronic
929150483 2:38743311-38743333 AATCACAGAAAACAAGTGGGGGG + Intergenic
929418524 2:41767967-41767989 TATCAGAGAAAGCAAGTGAGAGG + Intergenic
929480460 2:42302488-42302510 AATCACATGAAGAATGTGGTCGG - Intronic
930542231 2:52720959-52720981 TATCAAAAAAAGAATGTTTGTGG - Intergenic
931748617 2:65311971-65311993 TACCACAGAAAGATCGTGGCGGG + Exonic
931761582 2:65422140-65422162 TATGAGAGAAAGAATGAGTGAGG - Intronic
931797189 2:65722442-65722464 TATCACAGAACAAAGATGGGAGG - Intergenic
935160351 2:100524312-100524334 TATCACAGCAAGAATGAGCAGGG - Intergenic
935491010 2:103720238-103720260 CCTCACAGAATGAATGGGGGAGG - Intergenic
936344625 2:111665888-111665910 CATCACAGAAGGAAGGTGGAAGG - Intergenic
936434714 2:112494309-112494331 TATAACAGAAAGAAAGAGGATGG + Exonic
939448503 2:142341060-142341082 TATTACAGAAAGAAGGAGAGAGG - Intergenic
939697687 2:145347462-145347484 TATTTCAGAAAGAATGAGAGGGG + Intergenic
940262199 2:151792754-151792776 GATCACAGAAACCTTGTGGGCGG + Intronic
942626789 2:177909701-177909723 TATCACAGAAAGAAGGAAGGAGG - Intronic
943966684 2:194343193-194343215 TATCACAGAAAGAAATAGAGGGG + Intergenic
945779488 2:214151883-214151905 TTTCATATAAGGAATGTGGGTGG + Intronic
945823618 2:214694734-214694756 TATCACTGATTTAATGTGGGAGG - Intergenic
948915473 2:241032825-241032847 TATTACAGAAAAAATGTCAGAGG - Intronic
1168917588 20:1503848-1503870 TATCACAGACAGAAACTAGGTGG - Intergenic
1169951219 20:11045600-11045622 CATAAGGGAAAGAATGTGGGTGG - Intergenic
1172412462 20:34735338-34735360 CAGCAAAGAAAGAATCTGGGTGG + Intronic
1173945501 20:46946989-46947011 TAACACAGAATGAATGGGTGTGG - Intronic
1177265857 21:18782896-18782918 TATCACATAAGGAATGTGAAGGG - Intergenic
1182075562 22:27493190-27493212 TAGCACAGATGGGATGTGGGTGG + Intergenic
1183351523 22:37337287-37337309 TCTCACAGAAAGCAGGCGGGTGG - Intergenic
1184341434 22:43888150-43888172 TCTCACAGCAAGGATGTGAGGGG - Intronic
949335008 3:2965187-2965209 AATGAGACAAAGAATGTGGGAGG - Intronic
951892791 3:27582661-27582683 TGTCACAGAAACAATCTGGGTGG + Intergenic
952508546 3:34031382-34031404 TTACACAGAAAGAATCTGAGAGG + Intergenic
952771845 3:37008603-37008625 AATCAGTGAATGAATGTGGGAGG + Intronic
953160315 3:40413608-40413630 TCTCACTGAAAGACTGGGGGAGG - Intronic
953614956 3:44481714-44481736 TATTAGAGAAAGAATGTAAGGGG + Intergenic
955117327 3:56018524-56018546 AATGAAAGAAAGAATGAGGGAGG + Intronic
955458550 3:59152737-59152759 TAACACAAACAGAAGGTGGGAGG - Intergenic
956025188 3:64975821-64975843 TATCTAAGAAAGATTGTAGGAGG + Intergenic
956937057 3:74114910-74114932 TATAACAGAAAGCATGTGAAAGG + Intergenic
957517634 3:81276380-81276402 TATCATAAAGAAAATGTGGGGGG + Intergenic
957658132 3:83109597-83109619 GATCACAGAAAAACTGAGGGAGG + Intergenic
959082239 3:101814367-101814389 TATCAAAGAAAAATTGTCGGGGG - Intronic
959521919 3:107331289-107331311 TAGCACACAAAGTATATGGGGGG + Intergenic
961646713 3:128396655-128396677 TAACACAGCAAGAACGTGGTGGG - Intronic
961830681 3:129621564-129621586 TGGCACAGAAGGAGTGTGGGTGG - Intergenic
962076637 3:132088876-132088898 CATGAGAGTAAGAATGTGGGAGG - Intronic
963558079 3:146821497-146821519 TATCACAGAAACATTCTGTGGGG - Intergenic
964412042 3:156408018-156408040 AATCACAGAGAGATTGTGGAAGG + Intronic
965953378 3:174337945-174337967 AATCAGAGAAAGACTGAGGGAGG - Intergenic
969505587 4:7585245-7585267 TATCACAGGAAGAATGAGTTGGG + Intronic
970542117 4:17090605-17090627 TACCAAAGAAATAAAGTGGGAGG - Intergenic
977572384 4:98642249-98642271 AATCACAGAAAGAAGGGGGCAGG + Intronic
978235359 4:106451706-106451728 TATAAAAGAAAGAATGGGGTGGG - Intergenic
979834090 4:125339494-125339516 TACCATAGAAATAATGTTGGAGG - Intronic
979941215 4:126765519-126765541 TATCACAGAAATGATGTGCAGGG - Intergenic
980621011 4:135303663-135303685 TAACAAAGAAAGAATTTGGCTGG - Intergenic
981240476 4:142470650-142470672 TACCACAGCCAGCATGTGGGAGG + Intronic
981350705 4:143726181-143726203 AAACAGAGAAAGAATGTGTGAGG - Intergenic
982051522 4:151507125-151507147 TATCTCAAAAAAAAAGTGGGGGG - Intronic
983808575 4:172027147-172027169 AATCACAGAAATAATTTGGGAGG - Intronic
984710183 4:182878456-182878478 AATCTCAAAAAGAATGTGGCTGG - Intergenic
985140382 4:186833460-186833482 TAATACAGGAAGAATATGGGAGG - Intergenic
987163361 5:15168473-15168495 TAGAACAGAAACAATGTGGGTGG - Intergenic
987198161 5:15547984-15548006 GATCCCAGAAAGGATGTAGGTGG + Intronic
987685454 5:21193763-21193785 AATCACAGAATGAATATGGATGG - Intergenic
987900865 5:24010137-24010159 CATCATAGAATGAATTTGGGAGG - Intronic
988564959 5:32313143-32313165 AATCAGAGAAAGCATGAGGGCGG - Intergenic
990190194 5:53250989-53251011 TATTAAAGAAAGATTTTGGGGGG - Intergenic
991201641 5:64001033-64001055 TATCAGAGAAGGACTGTGGATGG - Intergenic
992462342 5:76972884-76972906 TATCACAGAAAGAATGTGGGTGG + Intronic
993620592 5:90163235-90163257 TATCACAGGAAGAGTGAGGAAGG + Intergenic
994671607 5:102768323-102768345 TAACACACAAAAAATGTGTGAGG - Intronic
994866771 5:105282773-105282795 AATAACAGAAAGAATGTTGATGG - Intergenic
996347215 5:122500113-122500135 TATCATAGGAACATTGTGGGTGG + Intergenic
997462529 5:134063432-134063454 AATCACTGAATCAATGTGGGAGG - Intergenic
998588835 5:143456178-143456200 TAGCACAGGAGGGATGTGGGAGG - Intergenic
1000052277 5:157574144-157574166 GAACACACAAAGAATGTGGAGGG + Intronic
1000932017 5:167263096-167263118 TTTCACTGTAAGAATTTGGGAGG + Intergenic
1001295024 5:170493128-170493150 TACCACAGAAACCAAGTGGGCGG - Intronic
1001748665 5:174111247-174111269 TATGACAGGAAGAATTCGGGAGG + Intronic
1005264743 6:24100356-24100378 TTTCTCAGAAAGAAAGAGGGAGG + Intergenic
1007610945 6:43148360-43148382 TAAAACAGAAAGCAAGTGGGAGG + Intronic
1008322822 6:50138547-50138569 TATCACAGAAATAATATCAGTGG + Intergenic
1008578586 6:52884649-52884671 TATTACAAGAAGAAAGTGGGTGG - Intronic
1008895112 6:56543778-56543800 TTTTACAGAAAAGATGTGGGAGG + Intronic
1009960460 6:70514815-70514837 TTTCACTGAAAGAAACTGGGAGG - Intronic
1010026252 6:71221026-71221048 TACCATAGAAAGAAAGTGGGTGG + Intergenic
1010409149 6:75540804-75540826 TATCACAGATTGAATGCAGGAGG + Intergenic
1011327441 6:86165069-86165091 TCTCACAGAATGAATTAGGGGGG - Intergenic
1011443761 6:87415108-87415130 TATCACAGGAGGAATGAGGAGGG + Intronic
1013215618 6:108024725-108024747 AAGCACAGTAAGAAAGTGGGTGG + Intergenic
1014072530 6:117199740-117199762 TATCACAGGAGGAATGTGTTGGG - Intergenic
1014330478 6:120057749-120057771 CTTCACAGAATGAATTTGGGAGG - Intergenic
1015638939 6:135309281-135309303 TGTCCCATAAAGAAGGTGGGTGG - Intronic
1016416383 6:143838962-143838984 GGACACAGAAAGAAAGTGGGGGG - Intronic
1017664120 6:156702948-156702970 TACCACAGAAAGAGGGAGGGTGG - Intergenic
1018349078 6:162937417-162937439 CAACACTGAAAGAATGCGGGAGG + Intronic
1018652071 6:166000632-166000654 TGTCACAGATAGCATGGGGGAGG - Intergenic
1019345384 7:527160-527182 GAACAAAGAAAGTATGTGGGTGG + Intergenic
1022689623 7:32635562-32635584 TAACACAGAGAGAAGGAGGGTGG + Intergenic
1022917190 7:34969740-34969762 TAACACAGAGAGAAGGAGGGTGG + Intronic
1022924960 7:35047438-35047460 GATGACAGCAAGAATGTGGACGG + Intergenic
1023062416 7:36341484-36341506 TTTCAAAATAAGAATGTGGGTGG - Intronic
1025489066 7:61088956-61088978 TATCTCAAAAAGAATGGGTGGGG - Intergenic
1026218882 7:68374325-68374347 TATCCCAGAAAGTATGTGAGTGG - Intergenic
1026373057 7:69721171-69721193 GATCAGAGAGAGATTGTGGGAGG - Intronic
1027375907 7:77549308-77549330 CATCTCTGAAAGAAGGTGGGTGG - Intronic
1028143362 7:87295356-87295378 TCTCACAGAAAGAGTTGGGGAGG - Intergenic
1028714128 7:93944771-93944793 TATTATAGAGAGACTGTGGGTGG + Intergenic
1029822970 7:103162143-103162165 GATGACAGCAAGAATGTGGACGG + Intergenic
1031631311 7:124046565-124046587 TATCCCAGAAGGAATATGGGTGG - Intergenic
1032217686 7:129970243-129970265 TCTCAGATAAAGAATGTGGGAGG - Intergenic
1032870528 7:135979682-135979704 AATCAAAGAAACAATGGGGGTGG - Intergenic
1033107842 7:138546017-138546039 TATCATAGAGATAATTTGGGAGG + Intronic
1033577584 7:142701117-142701139 TTTCACTGAACGAATGAGGGAGG - Intergenic
1034691538 7:153018138-153018160 GAGAAAAGAAAGAATGTGGGTGG - Intergenic
1034737856 7:153445789-153445811 CATCACAGATGGAATGAGGGTGG + Intergenic
1036740367 8:11355714-11355736 TATCACAGAGACAAAGTCGGTGG - Intergenic
1038617769 8:29111049-29111071 TAGAACAGATAAAATGTGGGAGG + Intronic
1040078911 8:43268184-43268206 TCTCACAGAAGGTATATGGGTGG - Intergenic
1041923832 8:63215226-63215248 CAGTACAGAAAGTATGTGGGGGG - Intergenic
1042018902 8:64348387-64348409 TATCACATAAATAAGGTGTGTGG - Intergenic
1046437578 8:114212217-114212239 TAGCACAGAATGAATGGGGGTGG + Intergenic
1046759310 8:118004759-118004781 TATTACATGGAGAATGTGGGTGG - Intronic
1047281488 8:123450080-123450102 TATCATTGAGAGAATGTGTGTGG + Intronic
1048405065 8:134110616-134110638 TTACCCAGAAAGAGTGTGGGTGG - Intergenic
1048605668 8:135966070-135966092 TATCACAAAAAAAGTGTGTGTGG + Intergenic
1048692738 8:136986445-136986467 TATTAAAGAAAGAAAGTTGGGGG - Intergenic
1051004286 9:12323773-12323795 CATGACAGAAAAAATGTGGTGGG - Intergenic
1051202311 9:14641047-14641069 TATAAAAGAAAGCATGTGGGTGG - Intronic
1051249720 9:15147104-15147126 TCTAACAGAAAGGAGGTGGGGGG + Intergenic
1051480675 9:17556667-17556689 GATGACAGATTGAATGTGGGAGG - Intergenic
1052674358 9:31600425-31600447 TTTTACAGAAAGAATGTGAAAGG + Intergenic
1054908312 9:70430138-70430160 TATCAACGTAAGAATGTTGGAGG + Intergenic
1056286208 9:85090374-85090396 TATCAAGGAAAGCATTTGGGAGG + Intergenic
1058518510 9:105798129-105798151 TATCGCAGAGGGAATGTAGGGGG + Intergenic
1059008436 9:110429837-110429859 TAACACTGAAAGAAAGGGGGTGG - Intronic
1186083947 X:5965666-5965688 TATCACATAAGGAGTGTGGCTGG - Intronic
1187090495 X:16091027-16091049 ATTCACTGAAAGATTGTGGGAGG + Intergenic
1187125430 X:16449936-16449958 TATCAAAGAAAGGGCGTGGGTGG - Intergenic
1187555921 X:20351053-20351075 TTTCACAAAAAGATTTTGGGTGG + Intergenic
1188475766 X:30590005-30590027 TATAACAGAAAGAATGAGCTTGG + Intergenic
1188984676 X:36758574-36758596 CCTGACAGAAAGAGTGTGGGTGG - Intergenic
1189438959 X:41017480-41017502 AATCAAAGGAAGAATGTGGGAGG - Intergenic
1191838435 X:65490329-65490351 TATGAGCCAAAGAATGTGGGTGG + Intronic
1192749529 X:73974777-73974799 TTTCACAGTAAGTAGGTGGGTGG + Intergenic
1194731249 X:97458128-97458150 CAACCCAGAAACAATGTGGGAGG + Intronic
1195015786 X:100779122-100779144 CCTCACAGAATGAATTTGGGAGG + Intergenic
1195160221 X:102163518-102163540 TATCACACGATGAAAGTGGGAGG + Intergenic
1195232443 X:102863955-102863977 CATCACAGTAGGAAAGTGGGAGG + Intergenic
1195237649 X:102917561-102917583 AATGACAGAGAGAAGGTGGGAGG + Intergenic
1195859914 X:109372663-109372685 TTTCACAGAAAAAAAGTAGGAGG - Intergenic
1197784331 X:130185659-130185681 CATCCAAGAAAGAATGGGGGTGG - Intergenic
1198308446 X:135405507-135405529 TATAAAAGAGAGAATGGGGGAGG + Intergenic
1198521242 X:137454912-137454934 TCTCAGAGAAAGAGTGTGTGTGG + Intergenic
1199931034 X:152522342-152522364 TGTGACAGAAACAATATGGGAGG + Intergenic
1200325712 X:155236605-155236627 AATGTAAGAAAGAATGTGGGAGG - Intronic
1202202207 Y:22365458-22365480 TATAACATAAAGAGTGGGGGCGG + Intronic