ID: 992465667

View in Genome Browser
Species Human (GRCh38)
Location 5:77001282-77001304
Sequence TGAACCAAGTAAAACGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992465664_992465667 2 Left 992465664 5:77001257-77001279 CCACAGCTTCTTCCTCTGAAGAC No data
Right 992465667 5:77001282-77001304 TGAACCAAGTAAAACGTGGCAGG No data
992465663_992465667 3 Left 992465663 5:77001256-77001278 CCCACAGCTTCTTCCTCTGAAGA No data
Right 992465667 5:77001282-77001304 TGAACCAAGTAAAACGTGGCAGG No data
992465661_992465667 10 Left 992465661 5:77001249-77001271 CCCTCTTCCCACAGCTTCTTCCT No data
Right 992465667 5:77001282-77001304 TGAACCAAGTAAAACGTGGCAGG No data
992465665_992465667 -10 Left 992465665 5:77001269-77001291 CCTCTGAAGACTGTGAACCAAGT No data
Right 992465667 5:77001282-77001304 TGAACCAAGTAAAACGTGGCAGG No data
992465662_992465667 9 Left 992465662 5:77001250-77001272 CCTCTTCCCACAGCTTCTTCCTC No data
Right 992465667 5:77001282-77001304 TGAACCAAGTAAAACGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992465667 Original CRISPR TGAACCAAGTAAAACGTGGC AGG Intergenic
No off target data available for this crispr