ID: 992473142

View in Genome Browser
Species Human (GRCh38)
Location 5:77077368-77077390
Sequence GCGCCCTCCGCCTCCGCTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 344}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992473138_992473142 7 Left 992473138 5:77077338-77077360 CCTGGGCCGCGGCGCGCTCTTCC 0: 1
1: 0
2: 3
3: 17
4: 160
Right 992473142 5:77077368-77077390 GCGCCCTCCGCCTCCGCTCCAGG 0: 1
1: 0
2: 1
3: 43
4: 344
992473139_992473142 1 Left 992473139 5:77077344-77077366 CCGCGGCGCGCTCTTCCTCCTGC 0: 1
1: 0
2: 2
3: 63
4: 627
Right 992473142 5:77077368-77077390 GCGCCCTCCGCCTCCGCTCCAGG 0: 1
1: 0
2: 1
3: 43
4: 344
992473132_992473142 25 Left 992473132 5:77077320-77077342 CCTGCAGTTCCCGGCGCGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 360
Right 992473142 5:77077368-77077390 GCGCCCTCCGCCTCCGCTCCAGG 0: 1
1: 0
2: 1
3: 43
4: 344
992473137_992473142 15 Left 992473137 5:77077330-77077352 CCGGCGCGCCTGGGCCGCGGCGC 0: 1
1: 0
2: 2
3: 39
4: 308
Right 992473142 5:77077368-77077390 GCGCCCTCCGCCTCCGCTCCAGG 0: 1
1: 0
2: 1
3: 43
4: 344
992473136_992473142 16 Left 992473136 5:77077329-77077351 CCCGGCGCGCCTGGGCCGCGGCG 0: 1
1: 0
2: 2
3: 40
4: 312
Right 992473142 5:77077368-77077390 GCGCCCTCCGCCTCCGCTCCAGG 0: 1
1: 0
2: 1
3: 43
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992473142 Original CRISPR GCGCCCTCCGCCTCCGCTCC AGG Exonic