ID: 992473143

View in Genome Browser
Species Human (GRCh38)
Location 5:77077369-77077391
Sequence CGCCCTCCGCCTCCGCTCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 226}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992473132_992473143 26 Left 992473132 5:77077320-77077342 CCTGCAGTTCCCGGCGCGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 360
Right 992473143 5:77077369-77077391 CGCCCTCCGCCTCCGCTCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 226
992473138_992473143 8 Left 992473138 5:77077338-77077360 CCTGGGCCGCGGCGCGCTCTTCC 0: 1
1: 0
2: 3
3: 17
4: 160
Right 992473143 5:77077369-77077391 CGCCCTCCGCCTCCGCTCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 226
992473137_992473143 16 Left 992473137 5:77077330-77077352 CCGGCGCGCCTGGGCCGCGGCGC 0: 1
1: 0
2: 2
3: 39
4: 308
Right 992473143 5:77077369-77077391 CGCCCTCCGCCTCCGCTCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 226
992473136_992473143 17 Left 992473136 5:77077329-77077351 CCCGGCGCGCCTGGGCCGCGGCG 0: 1
1: 0
2: 2
3: 40
4: 312
Right 992473143 5:77077369-77077391 CGCCCTCCGCCTCCGCTCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 226
992473139_992473143 2 Left 992473139 5:77077344-77077366 CCGCGGCGCGCTCTTCCTCCTGC 0: 1
1: 0
2: 2
3: 63
4: 627
Right 992473143 5:77077369-77077391 CGCCCTCCGCCTCCGCTCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992473143 Original CRISPR CGCCCTCCGCCTCCGCTCCA GGG Exonic