ID: 992473150

View in Genome Browser
Species Human (GRCh38)
Location 5:77077390-77077412
Sequence GGCGCGCTCGCCCTGCTCCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 81}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992473141_992473150 5 Left 992473141 5:77077362-77077384 CCTGCAGCGCCCTCCGCCTCCGC 0: 1
1: 1
2: 7
3: 65
4: 619
Right 992473150 5:77077390-77077412 GGCGCGCTCGCCCTGCTCCACGG 0: 1
1: 0
2: 2
3: 6
4: 81
992473144_992473150 -4 Left 992473144 5:77077371-77077393 CCCTCCGCCTCCGCTCCAGGGCG 0: 1
1: 0
2: 2
3: 14
4: 185
Right 992473150 5:77077390-77077412 GGCGCGCTCGCCCTGCTCCACGG 0: 1
1: 0
2: 2
3: 6
4: 81
992473146_992473150 -8 Left 992473146 5:77077375-77077397 CCGCCTCCGCTCCAGGGCGCGCT 0: 1
1: 0
2: 0
3: 19
4: 176
Right 992473150 5:77077390-77077412 GGCGCGCTCGCCCTGCTCCACGG 0: 1
1: 0
2: 2
3: 6
4: 81
992473140_992473150 8 Left 992473140 5:77077359-77077381 CCTCCTGCAGCGCCCTCCGCCTC 0: 1
1: 1
2: 8
3: 59
4: 569
Right 992473150 5:77077390-77077412 GGCGCGCTCGCCCTGCTCCACGG 0: 1
1: 0
2: 2
3: 6
4: 81
992473145_992473150 -5 Left 992473145 5:77077372-77077394 CCTCCGCCTCCGCTCCAGGGCGC 0: 1
1: 0
2: 1
3: 34
4: 410
Right 992473150 5:77077390-77077412 GGCGCGCTCGCCCTGCTCCACGG 0: 1
1: 0
2: 2
3: 6
4: 81
992473138_992473150 29 Left 992473138 5:77077338-77077360 CCTGGGCCGCGGCGCGCTCTTCC 0: 1
1: 0
2: 3
3: 17
4: 160
Right 992473150 5:77077390-77077412 GGCGCGCTCGCCCTGCTCCACGG 0: 1
1: 0
2: 2
3: 6
4: 81
992473139_992473150 23 Left 992473139 5:77077344-77077366 CCGCGGCGCGCTCTTCCTCCTGC 0: 1
1: 0
2: 2
3: 63
4: 627
Right 992473150 5:77077390-77077412 GGCGCGCTCGCCCTGCTCCACGG 0: 1
1: 0
2: 2
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992473150 Original CRISPR GGCGCGCTCGCCCTGCTCCA CGG Exonic