ID: 992476088

View in Genome Browser
Species Human (GRCh38)
Location 5:77102912-77102934
Sequence CCACGTGGTCAAGTGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992476088_992476094 12 Left 992476088 5:77102912-77102934 CCAGCACTCACTTGACCACGTGG No data
Right 992476094 5:77102947-77102969 GGGCAGCTTTCCATGTGAAGAGG No data
992476088_992476096 20 Left 992476088 5:77102912-77102934 CCAGCACTCACTTGACCACGTGG No data
Right 992476096 5:77102955-77102977 TTCCATGTGAAGAGGAGTGGTGG No data
992476088_992476097 21 Left 992476088 5:77102912-77102934 CCAGCACTCACTTGACCACGTGG No data
Right 992476097 5:77102956-77102978 TCCATGTGAAGAGGAGTGGTGGG No data
992476088_992476099 26 Left 992476088 5:77102912-77102934 CCAGCACTCACTTGACCACGTGG No data
Right 992476099 5:77102961-77102983 GTGAAGAGGAGTGGTGGGCAAGG No data
992476088_992476093 -8 Left 992476088 5:77102912-77102934 CCAGCACTCACTTGACCACGTGG No data
Right 992476093 5:77102927-77102949 CCACGTGGTCAGAGTAGGTCGGG No data
992476088_992476095 17 Left 992476088 5:77102912-77102934 CCAGCACTCACTTGACCACGTGG No data
Right 992476095 5:77102952-77102974 GCTTTCCATGTGAAGAGGAGTGG No data
992476088_992476091 -9 Left 992476088 5:77102912-77102934 CCAGCACTCACTTGACCACGTGG No data
Right 992476091 5:77102926-77102948 ACCACGTGGTCAGAGTAGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992476088 Original CRISPR CCACGTGGTCAAGTGAGTGC TGG (reversed) Intergenic