ID: 992483774

View in Genome Browser
Species Human (GRCh38)
Location 5:77176470-77176492
Sequence TCCTCCACCCACATTTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992483774_992483783 18 Left 992483774 5:77176470-77176492 CCCTGTCAAATGTGGGTGGAGGA No data
Right 992483783 5:77176511-77176533 CAGGAGGAGGGTGGATTCTTTGG No data
992483774_992483782 9 Left 992483774 5:77176470-77176492 CCCTGTCAAATGTGGGTGGAGGA No data
Right 992483782 5:77176502-77176524 GGGCATGAGCAGGAGGAGGGTGG No data
992483774_992483779 2 Left 992483774 5:77176470-77176492 CCCTGTCAAATGTGGGTGGAGGA No data
Right 992483779 5:77176495-77176517 TATTCATGGGCATGAGCAGGAGG No data
992483774_992483781 6 Left 992483774 5:77176470-77176492 CCCTGTCAAATGTGGGTGGAGGA No data
Right 992483781 5:77176499-77176521 CATGGGCATGAGCAGGAGGAGGG No data
992483774_992483778 -1 Left 992483774 5:77176470-77176492 CCCTGTCAAATGTGGGTGGAGGA No data
Right 992483778 5:77176492-77176514 AGATATTCATGGGCATGAGCAGG No data
992483774_992483780 5 Left 992483774 5:77176470-77176492 CCCTGTCAAATGTGGGTGGAGGA No data
Right 992483780 5:77176498-77176520 TCATGGGCATGAGCAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992483774 Original CRISPR TCCTCCACCCACATTTGACA GGG (reversed) Intergenic
No off target data available for this crispr