ID: 992483775

View in Genome Browser
Species Human (GRCh38)
Location 5:77176471-77176493
Sequence CTCCTCCACCCACATTTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992483775_992483780 4 Left 992483775 5:77176471-77176493 CCTGTCAAATGTGGGTGGAGGAG No data
Right 992483780 5:77176498-77176520 TCATGGGCATGAGCAGGAGGAGG No data
992483775_992483781 5 Left 992483775 5:77176471-77176493 CCTGTCAAATGTGGGTGGAGGAG No data
Right 992483781 5:77176499-77176521 CATGGGCATGAGCAGGAGGAGGG No data
992483775_992483783 17 Left 992483775 5:77176471-77176493 CCTGTCAAATGTGGGTGGAGGAG No data
Right 992483783 5:77176511-77176533 CAGGAGGAGGGTGGATTCTTTGG No data
992483775_992483778 -2 Left 992483775 5:77176471-77176493 CCTGTCAAATGTGGGTGGAGGAG No data
Right 992483778 5:77176492-77176514 AGATATTCATGGGCATGAGCAGG No data
992483775_992483779 1 Left 992483775 5:77176471-77176493 CCTGTCAAATGTGGGTGGAGGAG No data
Right 992483779 5:77176495-77176517 TATTCATGGGCATGAGCAGGAGG No data
992483775_992483782 8 Left 992483775 5:77176471-77176493 CCTGTCAAATGTGGGTGGAGGAG No data
Right 992483782 5:77176502-77176524 GGGCATGAGCAGGAGGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992483775 Original CRISPR CTCCTCCACCCACATTTGAC AGG (reversed) Intergenic
No off target data available for this crispr