ID: 992483781

View in Genome Browser
Species Human (GRCh38)
Location 5:77176499-77176521
Sequence CATGGGCATGAGCAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992483774_992483781 6 Left 992483774 5:77176470-77176492 CCCTGTCAAATGTGGGTGGAGGA No data
Right 992483781 5:77176499-77176521 CATGGGCATGAGCAGGAGGAGGG No data
992483775_992483781 5 Left 992483775 5:77176471-77176493 CCTGTCAAATGTGGGTGGAGGAG No data
Right 992483781 5:77176499-77176521 CATGGGCATGAGCAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992483781 Original CRISPR CATGGGCATGAGCAGGAGGA GGG Intergenic
No off target data available for this crispr