ID: 992484222

View in Genome Browser
Species Human (GRCh38)
Location 5:77180220-77180242
Sequence CTGGGTCCTAGCGCCCCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992484222_992484237 20 Left 992484222 5:77180220-77180242 CCGGGAGGGGCGCTAGGACCCAG No data
Right 992484237 5:77180263-77180285 GCGTCTGGAAAGTGAAGGCGCGG No data
992484222_992484226 -6 Left 992484222 5:77180220-77180242 CCGGGAGGGGCGCTAGGACCCAG No data
Right 992484226 5:77180237-77180259 ACCCAGGCACCCGCCGGCCCGGG No data
992484222_992484228 -5 Left 992484222 5:77180220-77180242 CCGGGAGGGGCGCTAGGACCCAG No data
Right 992484228 5:77180238-77180260 CCCAGGCACCCGCCGGCCCGGGG No data
992484222_992484225 -7 Left 992484222 5:77180220-77180242 CCGGGAGGGGCGCTAGGACCCAG No data
Right 992484225 5:77180236-77180258 GACCCAGGCACCCGCCGGCCCGG No data
992484222_992484239 29 Left 992484222 5:77180220-77180242 CCGGGAGGGGCGCTAGGACCCAG No data
Right 992484239 5:77180272-77180294 AAGTGAAGGCGCGGAGGCTCAGG No data
992484222_992484232 5 Left 992484222 5:77180220-77180242 CCGGGAGGGGCGCTAGGACCCAG No data
Right 992484232 5:77180248-77180270 CGCCGGCCCGGGGACGCGTCTGG No data
992484222_992484238 23 Left 992484222 5:77180220-77180242 CCGGGAGGGGCGCTAGGACCCAG No data
Right 992484238 5:77180266-77180288 TCTGGAAAGTGAAGGCGCGGAGG No data
992484222_992484236 15 Left 992484222 5:77180220-77180242 CCGGGAGGGGCGCTAGGACCCAG No data
Right 992484236 5:77180258-77180280 GGGACGCGTCTGGAAAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992484222 Original CRISPR CTGGGTCCTAGCGCCCCTCC CGG (reversed) Intergenic
No off target data available for this crispr