ID: 992487591

View in Genome Browser
Species Human (GRCh38)
Location 5:77210878-77210900
Sequence CCGCCCGCGCCCGCGGCCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 631
Summary {0: 1, 1: 0, 2: 6, 3: 83, 4: 541}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992487591_992487602 6 Left 992487591 5:77210878-77210900 CCGGCGGCCGCGGGCGCGGGCGG 0: 1
1: 0
2: 6
3: 83
4: 541
Right 992487602 5:77210907-77210929 GGGGGAGCCCGGCCGAGGGATGG 0: 1
1: 0
2: 2
3: 46
4: 387
992487591_992487599 -5 Left 992487591 5:77210878-77210900 CCGGCGGCCGCGGGCGCGGGCGG 0: 1
1: 0
2: 6
3: 83
4: 541
Right 992487599 5:77210896-77210918 GGCGGGCGCGCGGGGGAGCCCGG 0: 1
1: 0
2: 14
3: 101
4: 787
992487591_992487603 7 Left 992487591 5:77210878-77210900 CCGGCGGCCGCGGGCGCGGGCGG 0: 1
1: 0
2: 6
3: 83
4: 541
Right 992487603 5:77210908-77210930 GGGGAGCCCGGCCGAGGGATGGG 0: 1
1: 0
2: 1
3: 18
4: 184
992487591_992487600 1 Left 992487591 5:77210878-77210900 CCGGCGGCCGCGGGCGCGGGCGG 0: 1
1: 0
2: 6
3: 83
4: 541
Right 992487600 5:77210902-77210924 CGCGCGGGGGAGCCCGGCCGAGG 0: 1
1: 0
2: 0
3: 33
4: 293
992487591_992487601 2 Left 992487591 5:77210878-77210900 CCGGCGGCCGCGGGCGCGGGCGG 0: 1
1: 0
2: 6
3: 83
4: 541
Right 992487601 5:77210903-77210925 GCGCGGGGGAGCCCGGCCGAGGG 0: 1
1: 0
2: 0
3: 12
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992487591 Original CRISPR CCGCCCGCGCCCGCGGCCGC CGG (reversed) Exonic
900152047 1:1183018-1183040 CCACCCGCGCCTGAGGCCCCCGG - Exonic
900408475 1:2502609-2502631 CAGCCCGGGCCCGGGGCTGCTGG - Intronic
900633904 1:3652527-3652549 CCGCCCGCGCACCCGCCCGGAGG + Exonic
901023842 1:6268890-6268912 CCTCCCACGCCCTCGGCGGCTGG - Intronic
901086269 1:6613981-6614003 CCGCCCGAGCCCCCAGCCCCGGG + Exonic
901086619 1:6614889-6614911 CCCCACCCGCCCGCGGTCGCCGG - Intronic
901238573 1:7680286-7680308 CCTCCCGTCCCCGCGGGCGCTGG + Intronic
901641258 1:10694246-10694268 CCGCCCGAGACCGCGGCCCCCGG + Intronic
901641433 1:10694890-10694912 GCGAGCGCGCGCGCGGCCGCCGG - Intronic
901673099 1:10867296-10867318 CCCGCGCCGCCCGCGGCCGCCGG - Intergenic
901793060 1:11664496-11664518 CCGCCCGGACCAGCGCCCGCAGG - Intronic
901793073 1:11664519-11664541 CCGCCCGCGCCCCCCACCCCTGG - Intronic
901877470 1:12175176-12175198 CCGCCCACTCCCACGGCCTCTGG - Intronic
902916837 1:19644549-19644571 CACCCGGTGCCCGCGGCCGCCGG - Intronic
903398408 1:23020008-23020030 CCGCCCTCCCCCGCCGCCGCCGG + Intronic
903485696 1:23688318-23688340 CGGCGCGCGCCCGCAACCGCAGG - Intergenic
903652369 1:24929917-24929939 GCGCCCGCGCCGGCCGCCCCCGG - Intronic
905806985 1:40884386-40884408 CCGCCGCCGCCCGCGGCAGAGGG + Intergenic
906214257 1:44030143-44030165 CCGACCGCGCCCCTGCCCGCCGG - Intronic
910145680 1:84077920-84077942 CCGCCCGCCCCCGGGGTCCCGGG + Intergenic
912401472 1:109397465-109397487 CCTGCCGCGCCCGCGTCCCCCGG - Intronic
912793502 1:112675297-112675319 CTGCCCGCGCCCCCGGAGGCCGG + Intronic
914702905 1:150150233-150150255 CGCCCCGCGCCCGCGCCCGCTGG + Exonic
914702991 1:150150509-150150531 CCTCCCCCGCCCCCGGGCGCCGG + Intronic
915359511 1:155277672-155277694 CCGCCTGCGACCGCGGCCTCAGG + Exonic
915519904 1:156436122-156436144 CCCGCCGCGCCCGCGGCCGGAGG - Intergenic
916666926 1:166975342-166975364 CCGCCGCCGCCCGCTGCCGCGGG - Intronic
916694467 1:167221538-167221560 CCGCCCGGGCCCGCTCCCGGGGG - Intronic
917846694 1:179026020-179026042 CCGGCCGCCCCCGCCGCCTCCGG - Exonic
919097875 1:193059306-193059328 CCCCCCGCACCAGCTGCCGCCGG + Exonic
920029193 1:203026488-203026510 CCGCCCAAGCGCGCGGCCGCGGG - Intronic
920184591 1:204152082-204152104 CCGCCCCCGCCCCGGCCCGCGGG + Intergenic
920394097 1:205631561-205631583 CCGCCCCCGCTCCCGGCCGGTGG + Intronic
922739419 1:228007004-228007026 ACCCGCGCACCCGCGGCCGCAGG + Intergenic
923126734 1:231040177-231040199 CGGGCGGCGCCCGGGGCCGCGGG - Exonic
923191774 1:231626895-231626917 CCGCCGCCGCCGGCGGCGGCTGG - Exonic
923506445 1:234609747-234609769 CCGCCCGTGCCCGGGCCGGCCGG - Intergenic
924090105 1:240492923-240492945 CCCCGCGCGCGCCCGGCCGCTGG - Exonic
924289695 1:242524641-242524663 CCGCTCGGGACCGCAGCCGCCGG - Intronic
924436681 1:244048904-244048926 CCGGCCGCCGCCGCCGCCGCCGG - Intergenic
1063661558 10:8037702-8037724 CCGGCCGGGGCCGGGGCCGCGGG + Intergenic
1063929795 10:11017870-11017892 CCGCCCCCGCCCGCCGCACCTGG + Intronic
1065025317 10:21534891-21534913 CCGCCCCGTGCCGCGGCCGCGGG + Intronic
1065140165 10:22713352-22713374 CCCCCTCCGCCCGCGCCCGCCGG + Intronic
1065214940 10:23439716-23439738 GCGCCCGCCTCCGCCGCCGCCGG + Exonic
1065660263 10:27998869-27998891 GCGCCGGCGTGCGCGGCCGCAGG - Intronic
1067091254 10:43266762-43266784 CTGCCCGCGCCGGCGACCGGAGG + Intronic
1067096542 10:43305058-43305080 CCGCCCCCGCCCCCGCCCCCGGG + Intergenic
1067362416 10:45594709-45594731 CCGCGCGCAGCCGCCGCCGCTGG - Intronic
1069474566 10:68721385-68721407 CCGTCGCCGCCCGGGGCCGCCGG - Intronic
1071690873 10:87818290-87818312 CCCTCCGCGCCGGCGACCGCGGG - Intronic
1072089639 10:92115043-92115065 TCCCCCGCGCCCGCGGCCGCCGG - Intronic
1072421004 10:95290732-95290754 CCGTCCCCGACCGCGCCCGCGGG + Intronic
1073306048 10:102504186-102504208 CCCACCGCGCCCCCGGCCCCTGG + Exonic
1073465632 10:103693229-103693251 CCGCCCGCCCGCCCGCCCGCGGG + Intronic
1073503913 10:103967315-103967337 CTGCCCGCCTCCGAGGCCGCCGG + Exonic
1073812437 10:107164961-107164983 GCGCCGGGACCCGCGGCCGCGGG - Intergenic
1074088344 10:110225883-110225905 CCGCACCCGCCCGCGGCTGCCGG - Intronic
1074130387 10:110568163-110568185 CCGCCCGCGGCCGCCCCGGCGGG - Intronic
1074169721 10:110919955-110919977 CCGCCCGCCGCCGCCGCCGCAGG - Intronic
1074503275 10:114044636-114044658 GCGCCCGCGCGCGCGTCAGCAGG - Exonic
1074843309 10:117375555-117375577 GCGCCCGGGCACGCGGACGCGGG + Intergenic
1075802098 10:125160247-125160269 CGCCCCCAGCCCGCGGCCGCAGG + Intronic
1076404684 10:130203895-130203917 CCGCCCCCGCCCGATCCCGCCGG + Intergenic
1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG + Intergenic
1076736826 10:132462710-132462732 CCACCAGCTCCAGCGGCCGCCGG - Intergenic
1076792729 10:132785644-132785666 CCGCGCGCCACAGCGGCCGCGGG + Exonic
1077008402 11:369606-369628 CACCCCGGGCCCGCGGCCGAGGG + Intergenic
1077008404 11:369609-369631 CCGCCCTCGGCCGCGGGCCCGGG - Intergenic
1077037974 11:504395-504417 CCGCCCGCGCCCGCTCCGCCCGG + Intronic
1077049782 11:561406-561428 ACGCCAGGCCCCGCGGCCGCCGG - Exonic
1077247505 11:1546756-1546778 CTGCCCGCGCCCGCCGAGGCTGG - Intergenic
1077360792 11:2139431-2139453 CCGCGCGGGCCCTGGGCCGCGGG - Intronic
1081528520 11:43942875-43942897 CCGCCCGGCCCCGCAGACGCCGG + Exonic
1081773880 11:45665142-45665164 CCGCCCGCCCCGGAGCCCGCGGG + Intronic
1081831467 11:46119881-46119903 CCGCCCGCGCCCCCGCCGGGGGG - Intronic
1081831511 11:46119973-46119995 CCCCCGCCGCCGGCGGCCGCGGG - Intronic
1081831604 11:46120387-46120409 CCGCCCCCGCCCGCAGCCCCCGG + Intronic
1081937923 11:46917880-46917902 CCGCCCGAGCCCCCAGCCCCAGG + Intronic
1082658051 11:55874586-55874608 CCGCCCACCCCTCCGGCCGCCGG - Intergenic
1082986046 11:59172224-59172246 CAGCCCCAGCTCGCGGCCGCCGG + Intronic
1082986082 11:59172363-59172385 CCGCGCGCCGCCGCCGCCGCCGG - Intronic
1083171260 11:60925031-60925053 GCGCCCGGGACCGGGGCCGCCGG - Intronic
1083232609 11:61332819-61332841 CCGGCCGCCCCCGGGGCGGCGGG + Intronic
1083432574 11:62621958-62621980 CCGCCCGCGCCCGAGCAGGCGGG + Exonic
1083885713 11:65572599-65572621 CCGCCCGGGCCGCCGCCCGCAGG - Exonic
1083932288 11:65852641-65852663 CGGCCAGTGCCCGCAGCCGCCGG - Exonic
1084021343 11:66420067-66420089 CCGCCCCCGCCCCCGGCCCGCGG + Intergenic
1084028489 11:66467168-66467190 CCACCCGCACCCGCGACCGCAGG - Intronic
1084310330 11:68312864-68312886 GCGCCCGCGCACTTGGCCGCGGG - Intronic
1086697987 11:89865599-89865621 CCGCCCACGCCTCCGGCCGCCGG - Intergenic
1086708175 11:89978889-89978911 CCGCCCACGCCTCCGGCCGCCGG + Intergenic
1086888222 11:92226688-92226710 CCGCCCACGCTCCGGGCCGCAGG - Intergenic
1088223180 11:107591052-107591074 GCGCCCGCGCCCCCGGCTCCCGG + Intergenic
1088686739 11:112290203-112290225 CCGCCCGCGTCCCCGCCCCCCGG - Intergenic
1089273360 11:117316129-117316151 CTGCCCGCGCCGCCGCCCGCCGG - Exonic
1089442908 11:118531245-118531267 CCGCCCCCGCCCCCCGCCACCGG - Intronic
1089494987 11:118903299-118903321 CCGCCCCCGCCCCCGCCCCCAGG + Exonic
1090285567 11:125496177-125496199 CCGGCCGCTCCCGCGGCCCGTGG - Exonic
1091262523 11:134245646-134245668 CCGCCCCCGCCCCCAGCCGCTGG - Exonic
1092383603 12:8018763-8018785 CCGGCCCCGCCCGCAGCCGCTGG + Intergenic
1093894821 12:24563339-24563361 CCGCGCGTCCCCGCCGCCGCCGG + Intergenic
1094703997 12:32896964-32896986 CCGCCCCCGCCCCCGCCCCCGGG - Intergenic
1095687234 12:45050478-45050500 CCAGCCGCGCCCGCGCCCCCAGG - Intronic
1096241182 12:49961305-49961327 CCGCCCGCCCCCGCCGCCGGCGG + Intergenic
1096336946 12:50764058-50764080 CCGCCCCCGCCCCCGCCCCCAGG + Intronic
1096389585 12:51218086-51218108 CCGCCCGCGCCAGCCGCCGGGGG + Intergenic
1096994338 12:55829595-55829617 CCTTCCGTCCCCGCGGCCGCCGG + Exonic
1098105955 12:67069297-67069319 CCGCCGCCGCCCGGAGCCGCCGG - Intergenic
1098161045 12:67648661-67648683 CCGCCCTCCTCCGCCGCCGCAGG - Intronic
1099989554 12:89708555-89708577 CCGCCCGCGGCCGGGGGCGGCGG - Intronic
1100260652 12:92929334-92929356 GCGGGCCCGCCCGCGGCCGCCGG + Intergenic
1100315473 12:93441485-93441507 TCCCGCGCGCCCGCGGCCTCCGG + Intronic
1100632305 12:96400621-96400643 CAGGCCCCGCCCCCGGCCGCCGG - Intergenic
1101354687 12:103966013-103966035 CCGCCCGCATCAGCGGCCTCGGG + Exonic
1101910575 12:108857670-108857692 CCTCCCGCGCCGGCGCGCGCAGG + Intergenic
1102471400 12:113161797-113161819 CCGCCCCCGCCCCCGCCCCCAGG + Intronic
1102853894 12:116277307-116277329 CAGCCCGGGCCCGCTGCCCCCGG - Exonic
1103386328 12:120534980-120535002 TCGCCCCCGCCCACTGCCGCAGG - Intronic
1103432965 12:120903910-120903932 CCGAGCGAGCCCGCCGCCGCCGG - Exonic
1103595634 12:122022847-122022869 CGCCCCGCGCCCCTGGCCGCTGG - Intronic
1103856009 12:123972227-123972249 ACCCCCGCGCCCGCCCCCGCGGG - Intronic
1104030865 12:125065261-125065283 GCTCCAGCGCCCGCGGCCGGGGG - Intergenic
1104049446 12:125186154-125186176 CCGCGAGCGCCCGCGACCCCCGG + Intergenic
1104857241 12:131907988-131908010 CCACCCACCCCCGCGCCCGCCGG - Intronic
1104866936 12:131961343-131961365 CCGGCCCCACCCGCGGCTGCAGG - Exonic
1104885485 12:132104711-132104733 CCGGCCCCACCCGCGGCTGCAGG - Exonic
1104961492 12:132490353-132490375 CCGCCCGCGCCGGGGGTCCCAGG + Exonic
1106516941 13:30464644-30464666 CTGGCTCCGCCCGCGGCCGCCGG + Intronic
1106516945 13:30464650-30464672 CCGCCCGCGGCCGCCGGGGCCGG + Intronic
1106516946 13:30464653-30464675 GCGCCGGCCCCGGCGGCCGCGGG - Intronic
1106776750 13:33016582-33016604 CCTCCTGCCCCCGAGGCCGCGGG + Exonic
1107133347 13:36919730-36919752 CCGCCCGCGCCGCGGGCCCCGGG - Intronic
1108542069 13:51453634-51453656 CCGCCCGCGCCCGCTCGCGCCGG - Intronic
1112290904 13:98143399-98143421 GCCGCCGCGCCCTCGGCCGCCGG + Intronic
1112505028 13:99970396-99970418 CCGCCACCGCCCCCGGCCGGCGG - Exonic
1112752559 13:102597223-102597245 CCGCCCGCGCCCCCGCGCCCGGG - Intronic
1113200997 13:107867341-107867363 CCGCCCGCGGGCGCCGCCGCCGG + Intergenic
1113473285 13:110561769-110561791 CCGCCCCCGCCCCCGCCCCCGGG + Intergenic
1113494027 13:110713941-110713963 CGGCCCGCGCCCTCAGGCGCTGG + Intronic
1113517790 13:110915782-110915804 CAACCCGCGCCCCCGGCAGCCGG - Intergenic
1113541932 13:111115706-111115728 GCGCCCCCGCCCGCGCCCCCCGG + Intronic
1113771465 13:112911674-112911696 CCCGCCGCGCCCTCGGCCTCGGG - Intronic
1113834755 13:113321497-113321519 CCGCCCCCGCCCGCGCGCCCAGG + Intronic
1113937321 13:114001369-114001391 GACCCCGAGCCCGCGGCCGCGGG - Intronic
1113937406 13:114001708-114001730 GACCCCGAGCCCGCGGCCGCAGG - Intronic
1115545469 14:34462063-34462085 CCGGCCGCGCGCGCGGGGGCCGG - Intronic
1115851235 14:37591948-37591970 CCGCCCCCGCCGCCGGCCCCCGG + Exonic
1117424465 14:55580387-55580409 CCCCCCGCGCTCCCCGCCGCCGG - Intronic
1117912442 14:60648552-60648574 CCGCCCCCTCCCGCCCCCGCAGG - Intronic
1118024081 14:61751205-61751227 CCGCCCGCGGCCCCGGCCGTGGG + Intergenic
1118849302 14:69572293-69572315 CCGCCCGCTCCCGCCGCAGGAGG + Exonic
1119759643 14:77141483-77141505 CCGGCAGCGCCGGCAGCCGCGGG + Intronic
1120914782 14:89701623-89701645 GCGGCCGCGCCCGACGCCGCCGG - Intergenic
1121330495 14:93046580-93046602 CCCCCCCCGCCCCCGGCTGCTGG - Intronic
1122066041 14:99175094-99175116 CCCCCCGCGCCCGGGACCCCGGG + Exonic
1122081814 14:99272049-99272071 CCCCCCGGGCCCGCGGCGCCAGG - Intergenic
1122162389 14:99793636-99793658 GCGGCCTCGCCCGCGGCCGCCGG - Intronic
1122523539 14:102363397-102363419 CGTCCCGCGCCCTCGGCCCCCGG + Intronic
1122690240 14:103528815-103528837 CCCCCCGCCCCGCCGGCCGCGGG - Intergenic
1122768177 14:104085571-104085593 CTGCCCCCGCCCGCCTCCGCGGG + Intergenic
1122779499 14:104137750-104137772 TCGCCGGCATCCGCGGCCGCAGG - Intergenic
1123004606 14:105315150-105315172 CCCCCCGCGCCCCCGCCCGCCGG + Exonic
1123024986 14:105420167-105420189 CCGCCCGCCCTCGCGGCCCCCGG + Intronic
1124251143 15:28107078-28107100 CCGCTCGCTCGCGCGCCCGCCGG + Intergenic
1124929145 15:34101890-34101912 CCGGCCGCCACCGCCGCCGCTGG + Exonic
1125717455 15:41827429-41827451 GGGCCCGCCCCCGCCGCCGCGGG - Exonic
1126113350 15:45187897-45187919 CCGCCCGGGGCCGCGAACGCAGG - Intronic
1126348358 15:47718829-47718851 CCGCTCGCGCCGGCAGCCGCTGG + Exonic
1126626059 15:50686759-50686781 GCGCCCGCGCCCGCCTCCGCCGG + Exonic
1126777609 15:52112809-52112831 CCGCCCCGGCCCCCGGCCCCCGG + Intergenic
1127763598 15:62164512-62164534 CCGGCCACCCCCGCGGCCCCCGG - Exonic
1128067884 15:64775653-64775675 CCGGCCCCGCCCCCCGCCGCCGG - Intergenic
1128089764 15:64911707-64911729 CCCTCCGCGCCCGAGGCCGGCGG - Intronic
1128455633 15:67829871-67829893 CCGCGAGCGCGCGTGGCCGCCGG - Intronic
1128460608 15:67863867-67863889 CCTGCCCCTCCCGCGGCCGCTGG + Intergenic
1128992493 15:72272515-72272537 CCGCGCGCGGCCGCAGCCGACGG + Exonic
1130002613 15:80060055-80060077 GCGCGGGCGCCCGCGGCCGGGGG + Intronic
1131144342 15:90001675-90001697 CCCCCCGCGCCCCCGCCGGCCGG - Intronic
1131827189 15:96331222-96331244 CCGCCGCCGCCCGCAGTCGCTGG - Exonic
1132207623 15:99997447-99997469 CTGCCCGGGCCCCCGGCCGGCGG - Exonic
1132365185 15:101251747-101251769 CCGCTCGCGCGCGGGGACGCGGG + Exonic
1132398160 15:101489316-101489338 TCGCGCGCGCCGGAGGCCGCCGG + Intronic
1132552796 16:560312-560334 CCGACCGCGCTCGCGGCGGGAGG - Intergenic
1132585790 16:705345-705367 CCCACCTCCCCCGCGGCCGCTGG - Intronic
1132684727 16:1157566-1157588 CCGCCTGCGCCCGCCTCCCCGGG + Intronic
1132789680 16:1678575-1678597 CTGCCCGCGACCGAGGCCGAGGG + Intronic
1132789681 16:1678578-1678600 CCGCCCTCGGCCTCGGTCGCGGG - Intronic
1133021465 16:2968796-2968818 CCTCACGCGCCCGCAGCCGTCGG - Intronic
1133156453 16:3880137-3880159 CCGGCCGCCGCCGCCGCCGCCGG + Exonic
1133188358 16:4116054-4116076 CCGGCCCTGCCCGCGGCGGCGGG + Exonic
1133188361 16:4116060-4116082 CTGCCCGCGGCGGCGGGCGCTGG + Exonic
1133188364 16:4116063-4116085 CCCCCAGCGCCCGCCGCCGCGGG - Exonic
1133259424 16:4538559-4538581 CCGCCCCCGCCCGCGGCGCCTGG - Intronic
1133286667 16:4693911-4693933 CCGCCCGGGCCCGCCCGCGCCGG - Intronic
1133784332 16:8963308-8963330 CAGCCCCGGCCCCCGGCCGCAGG - Exonic
1134134204 16:11668712-11668734 CAGCCCGCGGGCGCGGCCCCTGG - Intronic
1134529890 16:14975087-14975109 TCCCCCGCGCCCGCGGCCGGCGG - Exonic
1134849860 16:17470862-17470884 CCCGCAGCTCCCGCGGCCGCCGG + Exonic
1135517748 16:23149436-23149458 CGGACCGCGCGCGCGCCCGCTGG - Intergenic
1136146742 16:28320736-28320758 CGGCCCGCGCCCCCCGCCGTCGG + Exonic
1136556509 16:31010520-31010542 CCGGCCCCGCCCCCGCCCGCAGG - Exonic
1137261154 16:46831054-46831076 CCGCCCGCGCGCCCGGCCCCCGG + Intronic
1137531738 16:49282330-49282352 GCCCTCGCGCCCGCGCCCGCTGG - Intergenic
1138450814 16:57092678-57092700 TCGGCCGGGCCCGCGGGCGCGGG - Exonic
1138681231 16:58684772-58684794 ACGCCCGCTCGGGCGGCCGCGGG + Intronic
1139866454 16:70065867-70065889 TCCCCCGCGCCCGCGGCCAGCGG + Intergenic
1141184739 16:81779305-81779327 CCGCTCACGCCCTCCGCCGCCGG - Exonic
1142067674 16:88072111-88072133 CCATCCACGCCCGCCGCCGCGGG - Exonic
1142130787 16:88430656-88430678 CCGCCCGCCGCCCCAGCCGCCGG - Intronic
1142156338 16:88534314-88534336 TCGCCCGGCCCCGCGGCCGACGG + Exonic
1142395409 16:89828782-89828804 CCGGCCTCACCCGCGGCCTCGGG - Exonic
1142591168 17:1006741-1006763 CCGCCCGGGCCCGTGGCTGGCGG - Intronic
1142591188 17:1006806-1006828 CCGCCCGGGCCCGTGGCTGGCGG - Intronic
1142591208 17:1006871-1006893 CCGCCCGGGCCCGTGGCTGGCGG - Intronic
1142591228 17:1006936-1006958 CCGCCCGGGCCCGTGGCTGGCGG - Intronic
1142591248 17:1007001-1007023 CCGCCCGGGCCCGTGGCTGGCGG - Intronic
1142591268 17:1007066-1007088 CCGCCCGGGCCCGTGGCTGGCGG - Intronic
1142591288 17:1007131-1007153 CCGCCCGGGCCCGTGGCTGGCGG - Intronic
1142670628 17:1485933-1485955 CCGCCCCCGCCCCCGGCCCGCGG - Intronic
1143026619 17:3945025-3945047 CCGCCCGCCCGCGCGTCCCCTGG + Intronic
1145912900 17:28552642-28552664 CCGCCCCCGGCCGGGGCCCCAGG + Exonic
1146393606 17:32444480-32444502 CCGGCCGCGGCCGCCGACGCCGG - Exonic
1146896524 17:36545400-36545422 CCGCCCGCCCGCCCGCCCGCCGG - Intronic
1147150449 17:38510889-38510911 CCGCCCGCGCCCGGGGACACGGG + Exonic
1147168561 17:38605582-38605604 CCGCCCCCGCCCCCGGCCGAGGG + Intronic
1147168598 17:38605702-38605724 CCCCCCGCGCCCCCGCCCGATGG - Exonic
1147792478 17:43022099-43022121 CCGGCAGCGCCCCCGGCCCCTGG - Exonic
1147967339 17:44200171-44200193 CCGCCCCCGTCCCCGTCCGCCGG - Intergenic
1148271734 17:46266930-46266952 CCGCGCGCGCGCGCCGCCGAGGG + Intergenic
1148733379 17:49851244-49851266 CCACCCGCCGCCGGGGCCGCGGG - Intergenic
1148842587 17:50508470-50508492 GCGCACGCGCCCGCCGCCGGCGG - Exonic
1149994351 17:61399194-61399216 CCGCCCGCGCCGGCCCCAGCAGG + Intergenic
1150003178 17:61454681-61454703 CCGCCCGCGTCCACTGACGCCGG - Intronic
1150423282 17:65056944-65056966 CCGGCCGCGGCTGCGGGCGCGGG - Intergenic
1150764651 17:67993624-67993646 CCGCCCGCGCTCGCCACCGAGGG - Intronic
1151210465 17:72540474-72540496 CCGCCCGCGCCCGCGCCCGGTGG + Intergenic
1151558728 17:74859991-74860013 CCGCCGGCGTCCGCGGCTCCGGG + Intronic
1151674061 17:75588991-75589013 TCGCCCTCGCCTGCCGCCGCTGG - Intergenic
1151756274 17:76076925-76076947 GCACCCGAGCCCGCGGCCACCGG - Exonic
1152212447 17:79009637-79009659 GTGACTGCGCCCGCGGCCGCCGG - Intronic
1152357256 17:79813302-79813324 CCGCCCCCGCCCGCTCCCCCGGG + Intergenic
1152362608 17:79839563-79839585 CCGCCCAGGCCCGGGGCCTCCGG - Intergenic
1152433118 17:80260541-80260563 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433131 17:80260571-80260593 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433144 17:80260601-80260623 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433157 17:80260631-80260653 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433170 17:80260661-80260683 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433183 17:80260691-80260713 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433196 17:80260721-80260743 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433209 17:80260751-80260773 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433222 17:80260781-80260803 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433235 17:80260811-80260833 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152809544 17:82375071-82375093 GCGCGCGCGCCCCCGGCCGCCGG - Exonic
1153382251 18:4454000-4454022 CCGCGCTCGCCCCCGGCTGCAGG - Intronic
1153457231 18:5295278-5295300 CCGCCCCCGCCCCCGGCCGCGGG - Intronic
1153515376 18:5896099-5896121 CCGCCCGGGCCCGAGTTCGCTGG - Intergenic
1154241566 18:12657982-12658004 GCGGCCGCGCGCGCCGCCGCCGG + Exonic
1156036601 18:32772086-32772108 CCGCCCGCGCGCCGGCCCGCCGG + Exonic
1156275817 18:35581797-35581819 CCGGCCGCGACCGCCGCGGCCGG + Intronic
1157609987 18:48950174-48950196 GCGCCGGCGCCCGCGGCTGGCGG + Exonic
1160500706 18:79400118-79400140 CCTCGCGCGCGCGCGACCGCAGG - Intronic
1160592140 18:79951001-79951023 CCGCGCGCTCCTGCGGCCTCGGG + Exonic
1160706257 19:531620-531642 GCGCCTGCGCGCCCGGCCGCAGG - Intergenic
1160789738 19:917931-917953 CCGCCCGGGCCCGCCCGCGCTGG - Intronic
1160873259 19:1286399-1286421 CCCCACGCGCGCGCCGCCGCCGG + Intronic
1160923891 19:1533827-1533849 CCTCCCGCAGCCGCCGCCGCAGG - Intronic
1160967547 19:1753307-1753329 CCGCCCGCGCCCGCTGGGGCAGG - Exonic
1160967552 19:1753313-1753335 CTGCGCCCGCCCGCGCCCGCTGG - Exonic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1160975049 19:1789105-1789127 ACGCCCACGTCCGCGGCTGCAGG + Exonic
1161065745 19:2236423-2236445 CCGCCCACGCCAGCAGCCACGGG - Exonic
1161115566 19:2494878-2494900 ACGCCAGCGCCCGCCGCCGTGGG - Intergenic
1161241156 19:3224699-3224721 CCGCCCGCCGCCGCCGCCGCCGG + Exonic
1161350070 19:3786392-3786414 CCGCGCGCCGCCGCCGCCGCCGG + Intronic
1161358184 19:3831427-3831449 CCGCCCGCGCCTGCAGGCTCAGG - Exonic
1161703059 19:5805313-5805335 CCGCCCGCGGCCGCCCCCTCCGG + Intergenic
1161707235 19:5827846-5827868 GCGCACGCGCGCGCCGCCGCCGG - Exonic
1161802680 19:6424640-6424662 CCGCCCCCGCCGGCGGGCGGCGG + Exonic
1162931956 19:13961967-13961989 GCGCCCCCGCCCTCCGCCGCTGG - Exonic
1162954285 19:14089911-14089933 CAGCCCCTGCACGCGGCCGCGGG + Exonic
1163008453 19:14410508-14410530 CCTCCCGCGCCTGCGCTCGCTGG - Intronic
1163012200 19:14433318-14433340 CCTCCGGCCCCAGCGGCCGCCGG - Intronic
1163091187 19:15021532-15021554 CCACCCTGGCCCGCAGCCGCAGG - Intronic
1163708632 19:18832393-18832415 GCGCCCGCGCCCGCGCCGCCCGG - Exonic
1164834757 19:31349901-31349923 GCGCCCCCGCCCCCGGCCCCAGG + Intergenic
1164855498 19:31517647-31517669 CCACCCCAGCCCGCGGCCTCTGG - Intergenic
1165079997 19:33301681-33301703 GCGCCCGCGCTCGGTGCCGCCGG - Exonic
1165080106 19:33302068-33302090 CCGGGCGCGCCCGCGGGCCCCGG - Exonic
1165129170 19:33621693-33621715 GCTCCCACCCCCGCGGCCGCCGG + Intergenic
1165199814 19:34134541-34134563 GCGCCTGCGCCCGAGGGCGCGGG + Intergenic
1165345682 19:35247989-35248011 GCGCCCCCGCCCTCGGTCGCAGG + Intergenic
1165349802 19:35269336-35269358 CCGGCCGCGCCTGAGGCCGGGGG - Intronic
1165871420 19:38975819-38975841 CCGCCCGCCCTCGCTCCCGCTGG - Exonic
1166042959 19:40214194-40214216 CCGCCCGAGCCCGCGGGCCATGG + Exonic
1166351312 19:42199740-42199762 GCGCCAGCGCCTGGGGCCGCCGG + Exonic
1166706022 19:44908511-44908533 CCTCCCGCCCTCTCGGCCGCAGG + Exonic
1166762678 19:45234691-45234713 CCGCCAGCGCCCTCGGCCTTGGG + Intronic
1167311246 19:48739130-48739152 CTTCCCACGCCCGCCGCCGCGGG + Exonic
1167428417 19:49441428-49441450 CCGCCCGGGCCCGCGGGCGGGGG - Exonic
1167797487 19:51719372-51719394 CCCACCGCGCCCGCCGCCGCGGG + Exonic
1168059249 19:53882236-53882258 CCGCCCGTGCCTCCGGCTGCCGG + Exonic
1168076173 19:53981983-53982005 CCGCCTGCGCCAGCGGGCCCAGG - Intronic
1168247049 19:55117610-55117632 CCGCCCGCCCCGGGGGCCGCCGG + Intergenic
1168297302 19:55383736-55383758 CTGCCCGCGCCCGCCGCCCCGGG + Exonic
1168336469 19:55600205-55600227 CCGCCCGCCTGCGCGCCCGCGGG - Intronic
925928171 2:8685359-8685381 CCTCCAGCGCCAGCGCCCGCGGG - Intergenic
926077377 2:9951935-9951957 CCGCCCGCCCGCGCGGCCTCGGG - Intronic
926914337 2:17878497-17878519 CCGCCCGCGCCCTCGGCCCGGGG + Intronic
927667453 2:25042334-25042356 GCGCCCGGGCCCGGGCCCGCGGG + Intronic
927943323 2:27119072-27119094 CCCGCTGCGCCCGCGGCCGGAGG + Exonic
927988340 2:27429031-27429053 CCGCCCCCGCCCCCACCCGCCGG - Intronic
928103287 2:28452038-28452060 CCGCCTGCTCCCACGGCCACAGG - Intergenic
929033705 2:37671800-37671822 CCGCGCGCGCGCCCGGCCACCGG - Exonic
929218224 2:39437501-39437523 CCGCGCCCGGCCGCTGCCGCCGG + Intergenic
929788580 2:45008567-45008589 CCGCCCGGTCGCGCTGCCGCCGG + Exonic
930046263 2:47175878-47175900 CCGCCCGCCCGCGCGCCCCCTGG + Intronic
930847765 2:55923796-55923818 CCGGCAGCGGCCGCGGCGGCAGG + Exonic
931671753 2:64653976-64653998 CCGCCCGACCCCGCCCCCGCCGG + Intronic
931671795 2:64654059-64654081 CCGCGGCCGGCCGCGGCCGCAGG + Intronic
932607674 2:73175833-73175855 GCGCCCGCCCCCGCCGCCGCGGG - Intergenic
932780211 2:74554637-74554659 CGGCCCCCGCCGGCAGCCGCTGG - Exonic
934588248 2:95525322-95525344 CAGCCCACGCCTCCGGCCGCTGG + Intergenic
934978344 2:98821925-98821947 CAGCCCGCGCCCCCCGACGCCGG - Exonic
935059302 2:99593817-99593839 CCCAGCGCGTCCGCGGCCGCGGG + Exonic
935265108 2:101387184-101387206 CGGCGCCCGCCCGGGGCCGCAGG + Exonic
935815524 2:106843185-106843207 CCGCGCGCGCGTGCGGACGCTGG - Exonic
936713612 2:115161428-115161450 ACCCGCGCGCCCACGGCCGCCGG - Intronic
936972115 2:118186014-118186036 CCGGCCCCGCCCGCGCCAGCTGG + Intergenic
937045003 2:118846593-118846615 GCGCCCGCGCCGGCGGCGGCTGG + Exonic
937065081 2:119011648-119011670 CCGCCCGCGAGCGCGGACACCGG - Intergenic
937368330 2:121281090-121281112 CCGCCCTGGCCCGGGGCCTCTGG + Intronic
938291410 2:130152735-130152757 CCGGCCACACCCGCGGCCCCAGG - Exonic
938465133 2:131520224-131520246 CCGGCCACACCCGCGGCCCCAGG + Intergenic
938727296 2:134120154-134120176 GCGCCCGGGGCCGCCGCCGCGGG - Intronic
940751254 2:157628952-157628974 CCGCCCGGGCCTGCTGCTGCAGG + Exonic
940830321 2:158457967-158457989 CCGCCCGCTGCCGAGGCTGCCGG + Intronic
940887500 2:159002173-159002195 CCGCCAGCCCCTCCGGCCGCAGG - Intronic
942241232 2:173965079-173965101 CAGCCCGGGGCCGCTGCCGCCGG - Intronic
942451086 2:176108168-176108190 CCCCCCTCCCCCGCGGCCCCCGG - Intronic
942505457 2:176637671-176637693 CCGCCCACGCACGAGGCCCCCGG - Intergenic
942505475 2:176637728-176637750 CCGCCCGCGCCCTCGCGCGTCGG + Intergenic
943658671 2:190534826-190534848 CAGCCTCCGCCCGCGGCCTCGGG + Intergenic
943669788 2:190648852-190648874 CCGCCCCCGCCCCCGCCCGGCGG + Intronic
944412848 2:199459316-199459338 ACTCCCGCGGCCGCGGCCGCCGG + Intronic
944412849 2:199459319-199459341 CTGCCGGCGGCCGCGGCCGCGGG - Intronic
945225858 2:207530424-207530446 CCGCACACACCCCCGGCCGCCGG - Intronic
946227027 2:218269658-218269680 CCGCGCGCCCCCGCGGACCCCGG - Intronic
946412638 2:219522737-219522759 CCGCCCGCCCCCGCGGCGGCCGG - Intronic
947669141 2:231925784-231925806 CCCCACGCGCCCGCCGGCGCGGG + Intronic
947754317 2:232550789-232550811 TCCCCCGCGCCCGCCCCCGCTGG + Intronic
1168878032 20:1184904-1184926 CCCACCGCGCCCGCTCCCGCCGG + Intronic
1169191459 20:3661138-3661160 GTCCCCGCGCCCGCTGCCGCCGG - Exonic
1169207779 20:3749728-3749750 GTGCCCGCGCTCGCCGCCGCAGG + Exonic
1169278434 20:4248722-4248744 CCGCCCGCGCCCGCGCTCCCCGG + Exonic
1169278457 20:4248797-4248819 CCGCCGCCGCCCGCGCCCCCCGG + Exonic
1171417440 20:24992640-24992662 GCGCCGGCCCCTGCGGCCGCAGG - Exonic
1171974847 20:31587901-31587923 GCGCCCTCGCCCCCGCCCGCCGG + Intergenic
1172100600 20:32482654-32482676 CCGCCAACGCCCGCGGCTTCCGG + Intronic
1172117240 20:32580411-32580433 CCGCCCAGACCAGCGGCCGCAGG + Intronic
1172118528 20:32584904-32584926 CGGCCCGCCCCCGAGGGCGCCGG - Intronic
1172118729 20:32585520-32585542 GCAGCCGCGCCCGCAGCCGCCGG + Intronic
1172274991 20:33674476-33674498 CGCCCCGCCCCCGCGGACGCCGG + Intergenic
1172421875 20:34825233-34825255 CCTCCAGCGCCCCCGCCCGCAGG + Intronic
1173210724 20:41029362-41029384 CCGCGCGCGCTCGCCGCCGGAGG + Intronic
1173243422 20:41317574-41317596 CCGGCCGCCCGCCCGGCCGCGGG - Intronic
1173494333 20:43507865-43507887 CAGCCCGCGCCCCCCGCCGGAGG - Intronic
1175199069 20:57265903-57265925 CCGCCCGCGCCCGCACCTCCAGG - Exonic
1175979575 20:62730697-62730719 CCGCCCTCACCCGTGGCTGCTGG - Intronic
1176061578 20:63175067-63175089 CCTCCCGCTCCCGCCCCCGCCGG + Intergenic
1176077408 20:63254629-63254651 CCACCCCCGCCTGCGGCCCCTGG + Intronic
1176194516 20:63831105-63831127 CCGCCCTCGCCCGCGCCCCATGG - Intronic
1176414871 21:6468297-6468319 ACGGCCCCGCCCGCGGCCTCCGG - Intergenic
1176547817 21:8209069-8209091 ACCCCTGCGCCCGCGCCCGCCGG + Intergenic
1176547820 21:8209072-8209094 CCGCCGGCGGGCGCGGGCGCAGG - Intergenic
1176547884 21:8209256-8209278 CCTCGCGCGCCCGCGGGCGCCGG + Intergenic
1176549293 21:8214485-8214507 CCGCCCACCCCCGCACCCGCCGG - Intergenic
1176555779 21:8253464-8253486 TCGCCGCCGCCCGCGGGCGCCGG + Intergenic
1176555780 21:8253467-8253489 CGGCCGGCGCCCGCGGGCGGCGG - Intergenic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176557186 21:8258708-8258730 CCGCCCACCCCCGCACCCGCCGG - Intergenic
1176568225 21:8397523-8397545 CCGCCCACCCCCGCACCCGCCGG - Intergenic
1176574644 21:8436304-8436326 ACCCCTGCGCCCGCGCCCGCCGG + Intergenic
1176574647 21:8436307-8436329 CCGCCGGCGGGCGCGGGCGCAGG - Intergenic
1176574716 21:8436498-8436520 TCGCCGCCGCCCGCGGGCGCCGG + Intergenic
1176574717 21:8436501-8436523 CGGCCGGCGCCCGCGGGCGGCGG - Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176576128 21:8441743-8441765 CCGCCCACCCCCGCACCCGCCGG - Intergenic
1176611257 21:8987596-8987618 ACCCCTGCGCCCGCGCCCGCCGG + Intergenic
1176611260 21:8987599-8987621 CCGCCGGCGGGCGCGGGCGCAGG - Intergenic
1176611330 21:8987791-8987813 TCGCCGCCGCCCGCGGGCGCCGG + Intergenic
1176611331 21:8987794-8987816 CGGCCGGCGCCCGCGGGCGGCGG - Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1178334672 21:31732286-31732308 GCGGCGGCGGCCGCGGCCGCGGG + Intergenic
1178914947 21:36700939-36700961 CCGCCCACGCCGGTTGCCGCTGG + Intronic
1178961874 21:37073135-37073157 ACGCCCGCCCCCGCGCTCGCTGG - Intronic
1179213735 21:39349118-39349140 CCCCCCGCGTCCCCGGCCGCGGG + Exonic
1179496952 21:41778181-41778203 CCGCCTGCGCCCCCCGCCGGGGG + Intergenic
1179511884 21:41878980-41879002 CCGCCGGGTCCCGCCGCCGCGGG - Exonic
1179690371 21:43076619-43076641 ACGGCCCCGCCCGCGGCCTCCGG - Intronic
1179784054 21:43719692-43719714 CCGCCCGCCCCCGCGGCAGTTGG - Intronic
1180201674 21:46228539-46228561 CCGCCACCGACCTCGGCCGCTGG - Exonic
1180650213 22:17370303-17370325 CCCCCCGCGCCCGGCCCCGCCGG - Intronic
1180962035 22:19766499-19766521 CCGCCGGCGCCGCCGGCCCCGGG - Exonic
1181811360 22:25405474-25405496 CCGCCCGCGCCCCAGGGAGCCGG + Intergenic
1181934572 22:26429465-26429487 CCGTCCGCGCGCCCGGGCGCAGG + Exonic
1182355345 22:29720245-29720267 GCCCCCGCGCCCCGGGCCGCCGG - Exonic
1182355372 22:29720334-29720356 CCGCCCGCTCCAGCCGCCCCCGG + Exonic
1182445532 22:30387347-30387369 CCCCCCGCGCCCGGGACCCCTGG - Exonic
1183504808 22:38202969-38202991 GAGCCCGCGCCCGCAGCCACAGG + Intronic
1184676267 22:46045024-46045046 CCGCCCTCGCCCGGCGGCGCTGG + Intergenic
1184680788 22:46071337-46071359 CCGCCCGCGCGCGCCGTCCCGGG + Intronic
1184698019 22:46150540-46150562 CCGCCCGCTGCCCCCGCCGCGGG - Intronic
1184767074 22:46577504-46577526 CCGCGGGCACCTGCGGCCGCAGG + Intronic
1185255202 22:49827757-49827779 GCGCCCGCGCCCGCGCCCGCCGG - Intergenic
1203252691 22_KI270733v1_random:125354-125376 ACCCCTGCGCCCGCGCCCGCCGG + Intergenic
1203252694 22_KI270733v1_random:125357-125379 CCGCCGGCGGGCGCGGGCGCAGG - Intergenic
1203252764 22_KI270733v1_random:125549-125571 TCGCCGCCGCCCGCGGGCGCCGG + Intergenic
1203252765 22_KI270733v1_random:125552-125574 CGGCCGGCGCCCGCGGGCGGCGG - Intergenic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203254178 22_KI270733v1_random:130801-130823 CCGCCCACCCCCGCACCCGCCGG - Intergenic
1203260748 22_KI270733v1_random:170441-170463 ACCCCTGCGCCCGCGCCCGCCGG + Intergenic
1203260751 22_KI270733v1_random:170444-170466 CCGCCGGCGGGCGCGGGCGCAGG - Intergenic
1203260820 22_KI270733v1_random:170635-170657 TCGCCGCCGCCCGCGGGCGCCGG + Intergenic
1203260821 22_KI270733v1_random:170638-170660 CGGCCGGCGCCCGCGGGCGGCGG - Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203262234 22_KI270733v1_random:175880-175902 CCGCCCACCCCCGCACCCGCCGG - Intergenic
949987522 3:9552697-9552719 CCGCCAGCCGCCGCCGCCGCCGG - Exonic
950021710 3:9792415-9792437 CCGCCCCCTCCCGCGGCCCCTGG - Exonic
950729827 3:14947765-14947787 CCCCGCGAGCCCGCGGCCCCCGG + Intronic
950759364 3:15206644-15206666 CGGCCCGGGCCTGCGGCCGAGGG + Intronic
951717479 3:25664599-25664621 CCGCCCGCGGGCGCCGCTGCAGG + Intronic
953326104 3:42013709-42013731 GCGCCCCCGCCCGCCGCCCCGGG + Intergenic
953623900 3:44555053-44555075 CCGACCCCGCCCGCGGCAGGTGG + Intergenic
953657077 3:44862264-44862286 CCGCCGGGGCCCCGGGCCGCGGG + Intronic
953929601 3:46999359-46999381 CCGCCAGCGCCTCCGGCTGCGGG + Exonic
956406367 3:68932489-68932511 CCGACTGCGCGCGCGGCTGCGGG - Exonic
956420234 3:69080020-69080042 CCCCCCGGGCCCGCTGCGGCTGG + Intronic
961377251 3:126475396-126475418 CCGCCCGGCCCCGCAACCGCGGG - Exonic
961446486 3:126983772-126983794 CCGTCCTCGCCCGCGGCCAGAGG - Intergenic
961827329 3:129606029-129606051 CCCCCCGCGCCCGCGGCGGGAGG + Exonic
962738864 3:138348665-138348687 CCGCCGGGCCCCGCGGCCGCCGG - Intronic
962891740 3:139678069-139678091 CTGCCCCCGCCCCCGCCCGCTGG + Intergenic
964227907 3:154428765-154428787 CCGGGTGCGCCCGCTGCCGCTGG - Exonic
966378693 3:179322885-179322907 CGGCCCGCGCCCCCTGCCGGAGG - Intergenic
967762434 3:193241117-193241139 CCGCCCGCCCGCCCGCCCGCCGG - Exonic
967859699 3:194141578-194141600 CCGCCCGCCCGCCCGCCCGCCGG - Intergenic
968046155 3:195624830-195624852 CGCCCCGCGCCCGCGTCCTCGGG - Intergenic
968308499 3:197665257-197665279 CGCCCCGCGCCCGCGTCCTCGGG + Intergenic
968319063 3:197749821-197749843 CCCGCCCCGCCCGCAGCCGCGGG + Exonic
968457164 4:705736-705758 CCGCCCACGCCCCTTGCCGCGGG + Intronic
968584666 4:1410623-1410645 CGGCCCGAGCCCGTGGCCTCCGG - Intergenic
968616324 4:1579257-1579279 CCGGCCCCGCCCGCGCCTGCTGG + Intergenic
969271356 4:6105443-6105465 CCGCCCCCTCCCCCGCCCGCGGG - Intronic
969346755 4:6575108-6575130 CCGCCCCCGCCCGCAGCCAATGG + Intergenic
971351809 4:25862609-25862631 CCGCCCCCACCCGCGTCCCCGGG + Intronic
972245818 4:37244692-37244714 CCGCCCGCGCCCGCCGTGGGAGG - Exonic
973246744 4:48017377-48017399 ACGCCCACCCCCGCGGCCCCGGG - Intronic
973613893 4:52659995-52660017 CCGCCCGAGCGCGCCGCTGCTGG - Intergenic
975779055 4:77819917-77819939 GGCCCCGCGGCCGCGGCCGCCGG + Intergenic
975779057 4:77819920-77819942 GCGCCGGCGGCCGCGGCCGCGGG - Intergenic
975973753 4:80072680-80072702 ACGCCGGCGCCTGCGGCAGCGGG + Intronic
978384712 4:108168005-108168027 GCGCCCGCCCCCGAGGCCGAAGG + Exonic
981093339 4:140755842-140755864 CCGCCCGCGGCCTGGGCTGCAGG - Intronic
981128404 4:141132624-141132646 CCGCCCGCCGCCCCGGCCCCGGG + Exonic
983249286 4:165326892-165326914 CCGCCCCCGCCCCCGCCCCCGGG + Intergenic
984714965 4:182917182-182917204 CCCCCAGCGTCCGCGGCCCCAGG + Intronic
984966390 4:185143613-185143635 CCGCCCGCCCGCCCGCCCGCGGG + Intronic
985129099 4:186723882-186723904 CCGGCCCCGCCCGCCGGCGCCGG + Intronic
985129659 4:186726766-186726788 CCGTCCGCGCCCGGGGCGGGGGG - Intergenic
985512873 5:321958-321980 CCGCCCCGTCCCGGGGCCGCCGG - Intronic
985696947 5:1346039-1346061 CCGCCCCTGCACGCGGCCTCGGG - Intergenic
985747156 5:1654045-1654067 CGCCCCGCGCCCGCGTCCTCGGG + Intergenic
986184508 5:5423011-5423033 CCCCCCGCGCCCGGGGCCCCGGG - Intronic
986330724 5:6714263-6714285 CGCCGCGCGCCCTCGGCCGCGGG - Intergenic
986330774 5:6714488-6714510 CCGCGCGGCCCCGCGCCCGCCGG + Intergenic
987132417 5:14871873-14871895 CAGCCCGCCCCCGGGGCCGCTGG - Intergenic
991063636 5:62403728-62403750 CCGCCCGCGGCGGCGGCCGATGG + Exonic
992067461 5:73120716-73120738 GCGCCTGCGCCGGCGGCGGCGGG + Intronic
992431688 5:76716369-76716391 CTGCCCGCACCCGGGCCCGCAGG + Exonic
992487591 5:77210878-77210900 CCGCCCGCGCCCGCGGCCGCCGG - Exonic
995354694 5:111224330-111224352 CCGCCGCCGCCCGCGCTCGCAGG - Exonic
996404298 5:123090647-123090669 GCGCCGGCGCCGGCGGGCGCGGG + Intronic
996404299 5:123090650-123090672 GCACCCGCGCCCGCCGGCGCCGG - Intronic
996785060 5:127229349-127229371 CCGCCCGGGCCCGCCGCAGCCGG + Intergenic
997013338 5:129904387-129904409 CCTCCCGCTCCCCCCGCCGCCGG - Intergenic
997297533 5:132777303-132777325 CCGCCCCTGCCCCCGCCCGCGGG + Exonic
997402007 5:133611146-133611168 CAGCCCTCGCTCGCGGCCGCGGG - Intronic
998850421 5:146345930-146345952 CTGCGCGCGCCCGGGGACGCGGG - Intergenic
999462910 5:151772166-151772188 CCGCGCGCGCCTGCGGCCGTTGG - Intronic
1001035127 5:168291932-168291954 CCGCCCGCTCCTCCCGCCGCCGG - Intronic
1002193794 5:177491768-177491790 CCGCCCGCGCCCACGCCATCAGG - Intronic
1002487732 5:179550923-179550945 GCGCCCGCGCCGGCGGCCAGCGG - Intronic
1003049415 6:2766049-2766071 CCCGCCGCGGCGGCGGCCGCCGG - Exonic
1003049469 6:2766240-2766262 CCGCCCGCACCCCCGGGCGCTGG + Exonic
1003871173 6:10404463-10404485 CCGCCCCGCCCCGCGGCCGGGGG - Intronic
1004924480 6:20403721-20403743 CCGCCCTCGCCCTGCGCCGCCGG + Intronic
1005913027 6:30327118-30327140 CCGCCCGGGCCCGAGGCGGGCGG - Intronic
1007431516 6:41779904-41779926 CCGCCCCGCCCCGCGGCCGCGGG + Intronic
1010001514 6:70954905-70954927 CCGCCCCCCCCCGCCGCCCCCGG - Intronic
1010244800 6:73653514-73653536 CCGCCCCCGCCCCCGCCCGGTGG + Intronic
1011459688 6:87590104-87590126 CCGCGCGCCCTCGCGGCTGCAGG - Intronic
1011610468 6:89146062-89146084 CCGCCCGCGCACGCGCCCAGAGG - Exonic
1011643057 6:89433159-89433181 CCCGCCGCGTCCGCCGCCGCAGG - Intronic
1012939669 6:105403214-105403236 CCGGCCGCGCCCGCGCCGCCCGG + Intergenic
1013117471 6:107114445-107114467 CGGCCCGCGGCGGCGGCGGCCGG - Intronic
1013170747 6:107634735-107634757 CCGCCCGCGCCCGGGGGGCCCGG - Exonic
1014233979 6:118935031-118935053 CCGCGCGTCCCCGCGGCCGGTGG - Exonic
1016982265 6:149864176-149864198 CCGCCGGCGCCCGCGACCTCGGG - Intergenic
1017174983 6:151494198-151494220 CCACCCCCGCGCGCGGCCGGCGG - Intronic
1019473381 7:1232931-1232953 CCGCCCGCGCCTCCCGCCGCTGG + Exonic
1020224844 7:6272277-6272299 CCGCCCCCTCCCTCGGCCCCCGG + Intronic
1020278219 7:6637276-6637298 CCGCCCGCGCCCGCGGGGGGAGG - Intergenic
1020278227 7:6637282-6637304 CCCGCCCCGCCCGCGCCCGCGGG - Intergenic
1020278290 7:6637467-6637489 CCGCCCGCGCCGCCGCCCACCGG - Intronic
1020418205 7:7969441-7969463 CCGCCCGCCGTCGCCGCCGCCGG + Exonic
1021411149 7:20331023-20331045 CCTCCTGCGCTCGCAGCCGCAGG + Intronic
1021992521 7:26152174-26152196 TCGGCTGCGCCCGCGGCCGGGGG + Intergenic
1022207606 7:28179780-28179802 CGGCCCCCGCCCGCGGCCGCCGG + Intronic
1022207611 7:28179786-28179808 CCGCCCGCGGCCGCCGGCCCCGG + Intronic
1023812949 7:43926505-43926527 CCGCCCGGGTCCCCGGCAGCGGG + Exonic
1024678605 7:51660689-51660711 CCTCCAGCCCCTGCGGCCGCTGG + Intergenic
1025078868 7:55965036-55965058 CAGCGCGCGCCTGAGGCCGCAGG + Intronic
1027421135 7:78019425-78019447 CCGGCCGGGCCCGCGACCCCCGG - Exonic
1029640664 7:101817121-101817143 CCTCCCGCGCCCGCACCCGGCGG - Intronic
1031051864 7:116953405-116953427 CCGCCCGCCGCCGGGGACGCGGG - Exonic
1031532009 7:122886692-122886714 CCGCCCGAGCGCCCGGACGCAGG + Intronic
1031986711 7:128168260-128168282 CCGCCCCAGCCCGCGTCCTCTGG - Intergenic
1032074566 7:128830335-128830357 CCCGCCGCGCCCGCGGCCCCCGG - Intergenic
1033033143 7:137846534-137846556 CTGGACGAGCCCGCGGCCGCCGG - Exonic
1033369734 7:140697131-140697153 CCGCCCGCGCCGGCGCCGACTGG - Intronic
1033390741 7:140924886-140924908 TCGGCTGCGCCCGGGGCCGCGGG - Intergenic
1034306297 7:150047704-150047726 CCGCCTGCGCCCGCGGGCCGAGG + Intergenic
1034324613 7:150219783-150219805 CAGCCAGCGCCAGCGCCCGCGGG + Intergenic
1034441216 7:151086862-151086884 CCGCCGCCGCCCCCGGCCCCGGG - Exonic
1034468881 7:151245459-151245481 CCGCCCCCGCGCGGAGCCGCAGG - Exonic
1034488725 7:151381746-151381768 ACGCCCGCCCCTGCGCCCGCAGG - Exonic
1034620286 7:152451663-152451685 CCCCCCCCGCCCCCCGCCGCAGG + Intergenic
1034768581 7:153749448-153749470 CAGCCAGCGCCAGCGCCCGCGGG - Intergenic
1034800550 7:154052949-154052971 CCGCCTGCGCCCGCGGGCCGAGG - Intronic
1035404263 7:158587840-158587862 CCGGCCCCGCCCCCGGCGGCAGG + Intergenic
1035553371 8:545670-545692 CCTCCGGCGCCCGAGGTCGCGGG + Exonic
1036723716 8:11201026-11201048 CGGCCGGCGCCGGGGGCCGCGGG + Exonic
1036910603 8:12754778-12754800 CCGCCCGGGCCCGCTCGCGCTGG + Exonic
1037826836 8:22164960-22164982 CCGCCCGGGCCGCGGGCCGCGGG - Exonic
1037903831 8:22703774-22703796 CCGCCCGCGGCCCGGGCGGCGGG - Intergenic
1038540376 8:28385917-28385939 CCCCGCGCGCCCGCGGCTGTCGG - Intronic
1039936590 8:42051624-42051646 CCGCCCGGCCCCGCGCTCGCGGG - Intronic
1039949010 8:42153266-42153288 CCGCCCGCAGCCGCGGCGCCGGG - Intronic
1039981027 8:42410206-42410228 CCGCCCGCCCGTGCAGCCGCTGG - Intergenic
1040581791 8:48704387-48704409 CCGCCAGTGCCCGTGGCCCCAGG - Intergenic
1040582573 8:48709198-48709220 CCGCCAGTGCCCGCGGCCCCAGG - Intergenic
1041059393 8:54021921-54021943 CCCGCCGCGCCCGCGTCCCCGGG - Intronic
1041355237 8:56993410-56993432 CCCCCATCGGCCGCGGCCGCGGG + Exonic
1041355240 8:56993413-56993435 GGGCCCGCGGCCGCGGCCGATGG - Exonic
1041689900 8:60678705-60678727 CCGCGCGCACCCGAAGCCGCGGG - Intergenic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1042190037 8:66177288-66177310 CCGGCCGAGCCTGCGGCTGCTGG + Exonic
1042591775 8:70403662-70403684 CCGCCCGCCCTCGCGGCCCCGGG + Intronic
1044719756 8:95134007-95134029 CCGCCGCCGCCCGCGGCCGTCGG + Exonic
1045367857 8:101493369-101493391 CCGGCCGCCCCCGCGCCCCCCGG - Intronic
1047393725 8:124475033-124475055 CCGCCCCCGGCCGCGGCCCCGGG + Exonic
1048554035 8:135457774-135457796 CCGCCCGCGCCCCCAGCGGCGGG - Exonic
1048833325 8:138496866-138496888 CTGCCCTCGCCCGCCGCCGCCGG + Intergenic
1049145983 8:141001300-141001322 CCGCGCGCGTGCGCGGCAGCCGG + Intronic
1049405744 8:142451140-142451162 CCGCCCCCTCCCGAGGCCGGAGG - Intronic
1049411443 8:142475627-142475649 CCGCCCGCACTCACGGCCGCAGG - Exonic
1049419411 8:142510407-142510429 CAGCCGGCGCCCTGGGCCGCGGG + Intronic
1049585450 8:143430652-143430674 CAGCCCGAGGCGGCGGCCGCGGG - Intergenic
1049719265 8:144108128-144108150 CCCCGCGCGCCCGCGCCCGCCGG + Exonic
1049724191 8:144137919-144137941 CCGCCCGCGCGCCCGGCGCCAGG - Exonic
1049761432 8:144333666-144333688 CCGCCAGCACCTGCGGCCCCTGG + Exonic
1049796855 8:144500950-144500972 CCTCCAGCGCCGGCAGCCGCGGG + Exonic
1049843200 8:144787244-144787266 CCCCGCGCGCCCGCCCCCGCCGG + Intronic
1049843758 8:144790003-144790025 CCACCCCCGCCCCCGGCCTCGGG + Intronic
1050873977 9:10612905-10612927 CCAGCCGCGCCCGCAGCCGGCGG - Intergenic
1050874023 9:10613108-10613130 CCGCCCCGGCCCCCGCCCGCCGG - Intergenic
1051170605 9:14315458-14315480 CCGCCGGCGCCCCGGGCCCCGGG - Intronic
1053050626 9:34958274-34958296 CCGCCCGCGCCGCCTGCTGCCGG + Intronic
1053114528 9:35489822-35489844 CGGCCCGCGCCCGCCCCCGCGGG - Intergenic
1053142778 9:35691279-35691301 CCGCCCCGGCCAGCGGCCTCGGG - Intergenic
1053312852 9:37030252-37030274 CCGCCCGAGCGGGCGGCCTCTGG + Intronic
1055321671 9:75088488-75088510 CCGCCCCGCCCCGCGGCCGCCGG - Intergenic
1055497169 9:76867204-76867226 CCGCCCCCGCCCCCGCCAGCAGG + Intronic
1056992268 9:91423493-91423515 CCGCGCGCACTCGCCGCCGCTGG + Intronic
1059414392 9:114154277-114154299 GCCCCCGCGCCCACGGCTGCGGG + Intergenic
1060544734 9:124453299-124453321 CCTTCCGCGCCGACGGCCGCTGG + Exonic
1060700940 9:125748017-125748039 GCGCCGGCTCCCGCGGCCGCGGG + Intronic
1060770253 9:126327054-126327076 CCGCCCGCCCTCCCGGCTGCAGG - Intronic
1060849173 9:126860624-126860646 CAGCCCGCGCCCCCCGCCCCCGG - Intergenic
1060952322 9:127612201-127612223 CCGCCGGCGCGCGCGGGGGCGGG - Intergenic
1061208092 9:129175953-129175975 CCTCCCTCCCCCGGGGCCGCCGG + Exonic
1061366023 9:130172778-130172800 CCGCCCCCGCCCCCGCCCCCCGG + Intronic
1061840681 9:133356892-133356914 CTGCCCGCCCACGCGTCCGCAGG + Exonic
1061863429 9:133479240-133479262 CCGGCCGCGCCCGGGGAAGCCGG - Intergenic
1062043948 9:134416642-134416664 CCTCCCCCGCCCCCCGCCGCAGG + Intronic
1062272235 9:135714808-135714830 CCGCGCGCCCCCGCAGCCGCCGG + Intronic
1062362291 9:136193692-136193714 CCGCCCGCGCCCGCTCCAGCTGG - Intergenic
1062574611 9:137200371-137200393 CCGCCCGCGCCGCCCGCCCCGGG - Exonic
1062579227 9:137222150-137222172 ACGCCCGCGCCCGCGCCCCTCGG - Intergenic
1062596546 9:137302337-137302359 ACGCGCGCGCCGGCGGCCCCGGG + Intergenic
1062598071 9:137307943-137307965 CTGCCCCCGCCCCCGCCCGCCGG - Intronic
1062630773 9:137462142-137462164 CCGCCCGCCTCCGCCGCCGCGGG + Intronic
1203469095 Un_GL000220v1:108506-108528 ACCCCTGCGCCCGCGCCCGCCGG + Intergenic
1203469098 Un_GL000220v1:108509-108531 CCGCCGGCGGGCGCGGGCGCAGG - Intergenic
1203469167 Un_GL000220v1:108700-108722 TCGCCGCCGCCCGCGGGCGCCGG + Intergenic
1203469168 Un_GL000220v1:108703-108725 CGGCCGGCGCCCGCGGGCGGCGG - Intergenic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203470579 Un_GL000220v1:113945-113967 CCGCCCACCCCCGCACCCGCCGG - Intergenic
1203476916 Un_GL000220v1:152478-152500 ACCCCTGCGCCCGCGCCCGCCGG + Intergenic
1203476919 Un_GL000220v1:152481-152503 CCGCCGGCGGGCGCGGGCGCAGG - Intergenic
1203476988 Un_GL000220v1:152672-152694 TCGCCGCCGCCCGCGGGCGCCGG + Intergenic
1203476989 Un_GL000220v1:152675-152697 CGGCCGGCGCCCGCGGGCGGCGG - Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203478400 Un_GL000220v1:157917-157939 CCGCCCACCCCCGCACCCGCCGG - Intergenic
1185778813 X:2828862-2828884 CCGCCAGCCCCCGCGGGCGCGGG - Exonic
1186670018 X:11758408-11758430 CCGCCCCCGCCCCCGGTCCCGGG - Intronic
1187172924 X:16869759-16869781 CCTCCGGCGCCCTCGGCCCCGGG - Exonic
1189821326 X:44872779-44872801 CCGCTCGCGCCCGCCGCGGGCGG + Intergenic
1190274478 X:48891412-48891434 CCGCCCCAGCCAGCGGCCGGAGG + Intergenic
1190554389 X:51618666-51618688 CCTCCCGGGCCCGCCGCCACCGG + Intergenic
1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG + Intronic
1192533718 X:71911064-71911086 CCGGCCGCGGGCGCGGGCGCAGG - Intergenic
1197754430 X:129984095-129984117 CCGCCCGCCCGCCCCGCCGCCGG - Intronic
1199595855 X:149505265-149505287 CCGCCCGGGCCCGCAGGCCCGGG + Intronic
1199699296 X:150364221-150364243 CCGCCCGCGCTAGCCGGCGCCGG - Intronic
1199772641 X:150984154-150984176 CCGCCCCGGGCCGCGGGCGCCGG - Intronic
1200173702 X:154097452-154097474 CCTCCCCCTCCCGCCGCCGCCGG - Intronic
1200249885 X:154547181-154547203 CCGCGAGCGCGCGAGGCCGCCGG - Exonic
1200323726 X:155216436-155216458 CCTCCCGGGCCGCCGGCCGCCGG - Exonic
1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG + Intronic