ID: 992488023

View in Genome Browser
Species Human (GRCh38)
Location 5:77214378-77214400
Sequence CTGTATGAATGGAGGGAAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 412}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992488023_992488027 9 Left 992488023 5:77214378-77214400 CCGTTTTCCCTCCATTCATACAG 0: 1
1: 0
2: 1
3: 32
4: 412
Right 992488027 5:77214410-77214432 ATTTGTTCATTCAGTATTTGTGG 0: 1
1: 0
2: 7
3: 73
4: 574
992488023_992488028 26 Left 992488023 5:77214378-77214400 CCGTTTTCCCTCCATTCATACAG 0: 1
1: 0
2: 1
3: 32
4: 412
Right 992488028 5:77214427-77214449 TTGTGGCCAGACTGTGTTGTAGG 0: 1
1: 0
2: 0
3: 14
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992488023 Original CRISPR CTGTATGAATGGAGGGAAAA CGG (reversed) Intronic
900433313 1:2612936-2612958 CTGAATGGAAGGAGGGAACAGGG + Intronic
901573323 1:10179719-10179741 CTGGATGTCTGCAGGGAAAAAGG - Intronic
902648180 1:17818644-17818666 CTGAATGAAGTGAGGGAATAAGG - Intronic
907096578 1:51786900-51786922 TAGTATGAATGGAGAGAATAAGG - Intronic
907392605 1:54168141-54168163 TTGGAACAATGGAGGGAAAATGG - Intronic
907586999 1:55628121-55628143 GAGTATGAATGGAGGAAGAAAGG - Intergenic
907710093 1:56872537-56872559 GGGTATGAATTGTGGGAAAAAGG + Intronic
908089659 1:60672384-60672406 CTATATGAATGGAGGAAGGAGGG + Intergenic
908421305 1:63961083-63961105 AAGGATGAATGGAGGGAAGAAGG - Intronic
910159874 1:84261205-84261227 TTGTAACAAAGGAGGGAAAATGG + Intergenic
910898534 1:92094358-92094380 CTGTATGAAAAGAAGGCAAAAGG + Intronic
911080474 1:93924390-93924412 GTTTATGAATGGATGCAAAAAGG - Intergenic
911671584 1:100614317-100614339 CTGACTGAATGGAAGGAACATGG - Intergenic
911788625 1:101982713-101982735 AAGTATGAATGCAGGAAAAAAGG - Intronic
912654365 1:111472376-111472398 TTGGATGGATGGAGGGAGAAAGG - Intergenic
912761498 1:112371345-112371367 ACTTATGAGTGGAGGGAAAAGGG - Intergenic
913501783 1:119478401-119478423 CTGTTAGAATGGAGCGAAGAAGG + Intergenic
915061574 1:153190192-153190214 CTGTATGAAGGGTGGGAGACAGG - Intergenic
915669969 1:157479963-157479985 CAGTAAGAAAGGAGAGAAAAGGG - Intergenic
916385994 1:164270990-164271012 CTGTATCCAAGGAGGGAAGAGGG - Intergenic
916664697 1:166955926-166955948 CTGCATAATTGTAGGGAAAAAGG - Intronic
916681363 1:167108155-167108177 CTGGATGAATGGATGGACCATGG - Intronic
918312544 1:183295434-183295456 CTGCATGAAGGGAGGTAAAAAGG - Intronic
920126527 1:203698113-203698135 ATGAATGAATGTAGGAAAAAAGG - Intronic
921516057 1:216093569-216093591 CTGTAGGATAGGAGGGTAAAGGG - Intronic
923067368 1:230531040-230531062 TGGTATGAATGTGGGGAAAAGGG + Intergenic
923185680 1:231570948-231570970 CTTCATGTATGGAGGTAAAATGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924150603 1:241125380-241125402 CTAGATGATTGGAGGAAAAAGGG - Intronic
924840231 1:247702141-247702163 CTGTTTGAAAGGAGAGAAGAAGG + Intergenic
1063238609 10:4145315-4145337 CTGTAAGAAAGGGAGGAAAATGG - Intergenic
1063926841 10:10986869-10986891 CTATATCAAAGGAGGGAAGAAGG + Intergenic
1064001606 10:11668197-11668219 CTGGAAGAAGGGATGGAAAAGGG + Intergenic
1064547947 10:16469495-16469517 CTGTGAGAATGAAGGGGAAAAGG + Intronic
1064601341 10:16996885-16996907 CTTTAGGAATGAAGGGATAAGGG - Intronic
1065233282 10:23621090-23621112 GTGCATGTAGGGAGGGAAAAAGG + Intergenic
1065626810 10:27638259-27638281 GAGGATGAATGGAGGGATAATGG + Intergenic
1065998881 10:31085879-31085901 CTTTATCACTGGAGGAAAAAGGG - Intergenic
1067205785 10:44211784-44211806 CTGTATGAATGGGCAAAAAAAGG + Intergenic
1070127158 10:73631811-73631833 TTATGGGAATGGAGGGAAAAAGG - Exonic
1071137511 10:82469202-82469224 CGGAAGGAAGGGAGGGAAAAGGG - Intronic
1071368137 10:84922370-84922392 CTGTATCTGTGGAGGGACAATGG + Intergenic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1075298122 10:121296020-121296042 CTTTGTGAATGGATAGAAAATGG + Intergenic
1076282020 10:129254541-129254563 ATCTATGAAAGGTGGGAAAATGG - Intergenic
1076934360 10:133557516-133557538 ATGGATGAATGGAGAGAGAATGG + Intronic
1076946904 10:133657829-133657851 CTGTTTGAATGCAGAGAAAGTGG + Intergenic
1077280595 11:1743377-1743399 ATGGATGAATGGATGGAAGATGG + Intronic
1079874963 11:25845043-25845065 GTCAATGAATGGAGGGAAATTGG - Intergenic
1080160856 11:29174350-29174372 GTATATGAATGGAGGTAAGATGG - Intergenic
1080577130 11:33609998-33610020 CTGTATCATTGGTGGGATAAGGG + Intronic
1081276341 11:41153886-41153908 CTTTATAAAAGGAGGGTAAAGGG + Intronic
1081984372 11:47290868-47290890 CTGGATGAATTGAGGAGAAAGGG - Intronic
1085642947 11:78204618-78204640 ATGAATGAATAGAGGCAAAAAGG - Intronic
1085871149 11:80350671-80350693 CAGTTTGAATGGCAGGAAAAGGG + Intergenic
1087511268 11:99097843-99097865 CTGTATAAATTGAAGGTAAAAGG + Intronic
1088824576 11:113483019-113483041 ATGTATGGATGCAGGGAAGAGGG - Intergenic
1089221115 11:116872766-116872788 ATGGATTAAAGGAGGGAAAAGGG + Intronic
1090675174 11:128985678-128985700 ATGAATGAATGGATGGACAAAGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091463793 12:666118-666140 CTGGCTGAATAGAGGGAAACAGG + Intergenic
1092317390 12:7432344-7432366 CAGTATGTATGGAAAGAAAAAGG - Intronic
1092996979 12:13959711-13959733 CTGATTGAATGAAGGGAGAAGGG + Intronic
1093233974 12:16583703-16583725 CTGTAGGAATGGATTGAAAAAGG + Intronic
1095382112 12:41607407-41607429 CTGAATGAATGGAGGGGAGGGGG + Intergenic
1095578194 12:43763705-43763727 GAGTATGAGGGGAGGGAAAATGG - Intronic
1097742533 12:63260898-63260920 ATGAATGAATGGAGGGAATCTGG + Intergenic
1098444105 12:70548584-70548606 CTGAATGAATGCAGATAAAAAGG + Intronic
1098611824 12:72468059-72468081 ATGGAAGAATGGAGGGGAAAAGG - Intronic
1098700525 12:73618862-73618884 ATGTATGAATGGAAGGAGAAAGG - Intergenic
1098986476 12:77017847-77017869 TTGTAGGAAGGGAGGGAAAGTGG + Intergenic
1099070081 12:78035280-78035302 CTTTATCAAATGAGGGAAAATGG - Intronic
1099724922 12:86413174-86413196 GAATAAGAATGGAGGGAAAATGG + Intronic
1102009258 12:109607914-109607936 CTGGATGAATGGATGCATAAAGG + Intergenic
1102216249 12:111163504-111163526 CTCCAGGAATGGAGGGACAATGG - Intronic
1102420867 12:112801792-112801814 GTCTATGAATGGAGGGGAATGGG - Intronic
1104896439 12:132167148-132167170 GTGGATGAATGGATGGATAAGGG - Intergenic
1104908468 12:132228192-132228214 CTGCATGAGTGGAGGGCAGAGGG - Intronic
1105225108 13:18424758-18424780 CTTTAGGTGTGGAGGGAAAAGGG - Intergenic
1105253764 13:18725725-18725747 CTGAATCCATGGAGAGAAAAAGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106966507 13:35077569-35077591 CAATATGGATGGAGGGGAAAGGG - Intronic
1107836957 13:44420070-44420092 ATGAATGAATGAATGGAAAAGGG - Intergenic
1108698935 13:52927271-52927293 ATGAATGGAAGGAGGGAAAAAGG - Intergenic
1108959947 13:56214358-56214380 CTGCATGAATCCAGGGAGAAAGG - Intergenic
1109567553 13:64137193-64137215 TTGTGTGAATGCAGTGAAAAGGG + Intergenic
1109704358 13:66070590-66070612 TTGTAAAAATGGAGGGAAAATGG + Intergenic
1110470009 13:75848891-75848913 TGGTGTGAATGCAGGGAAAAGGG - Intronic
1110497750 13:76189615-76189637 AGGTAAGAATGGAGGGAAAAGGG - Intergenic
1110738161 13:78962833-78962855 CTAAATGAATAGAGGAAAAAGGG - Intergenic
1111070859 13:83166522-83166544 ATGTATGAATGCAGAGGAAAGGG - Intergenic
1111140414 13:84111182-84111204 CTATATGTATGGAGTGAAATTGG + Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1111309067 13:86457710-86457732 TGGCATGAATGCAGGGAAAAAGG - Intergenic
1111786921 13:92799745-92799767 GTGTGTGAAGGGAGAGAAAAAGG - Intronic
1111908895 13:94287998-94288020 ATGAATGAATGGAATGAAAAGGG - Intronic
1112646657 13:101340433-101340455 CTGTGTTATTTGAGGGAAAATGG - Intronic
1114887849 14:26877048-26877070 ATGTATTTATGGAGGGGAAAAGG - Intergenic
1115528990 14:34308746-34308768 CTGTGTGAAGGAAAGGAAAAAGG - Intronic
1115720048 14:36150661-36150683 TTCTAAGAAAGGAGGGAAAATGG - Intergenic
1117369832 14:55067224-55067246 ATGTAAGAATGGAGATAAAAGGG + Exonic
1118337912 14:64870107-64870129 CTGTAAGAAAGGAGTGAAAAGGG + Intronic
1119477376 14:74938962-74938984 CTGTGTGAAAGAAGAGAAAAGGG - Intergenic
1119859537 14:77926138-77926160 CTGGATGGAAGGAGGGAAAGGGG + Intronic
1123130364 14:105980906-105980928 ATGTATGAATGGAGGGGAAGTGG - Intergenic
1202920978 14_KI270723v1_random:30385-30407 CTGTTTGAATGCAGAGAAAGTGG + Intergenic
1202923939 14_KI270724v1_random:7196-7218 CTGTTTGAATGCAGAGAAAGTGG - Intergenic
1123570272 15:21598802-21598824 CAGTAAGAATGCAGAGAAAAGGG - Intergenic
1123606383 15:22034122-22034144 CAGTAAGAATGCAGAGAAAAGGG - Intergenic
1124186707 15:27536465-27536487 TTTTATGAATGGATGGAAATAGG + Exonic
1125058767 15:35393499-35393521 AAGTATGAATGGAGGACAAAAGG + Intronic
1125972842 15:43926099-43926121 CTGAATGAATAGAAGGGAAAAGG + Intronic
1126164128 15:45639504-45639526 CTACATGAATGGAGAGAAAATGG + Intronic
1126359142 15:47827944-47827966 CTCTATGAACGGAGGGAAGTGGG - Intergenic
1126463126 15:48935188-48935210 ATGTATGAATGGATGAATAATGG + Intronic
1127001841 15:54517928-54517950 TTGTATAAATAGAGGTAAAAAGG + Intronic
1127300860 15:57652159-57652181 ATGAAGGAATGGAGGGAAAAAGG - Intronic
1127370328 15:58332874-58332896 CTCCATGAATGGAGGCAACAAGG + Intronic
1128527699 15:68423702-68423724 CTGGATGAATGGGGGCAAGAGGG + Intronic
1129590220 15:76908196-76908218 CTGAGAGAATTGAGGGAAAATGG - Intergenic
1129633932 15:77294021-77294043 CTGCATTCATGGAAGGAAAAAGG + Intronic
1202978623 15_KI270727v1_random:325893-325915 CAGTAAGAATGCAGAGAAAAGGG - Intergenic
1135110177 16:19684577-19684599 CTGTAAGGATTAAGGGAAAAAGG - Intronic
1135421634 16:22309065-22309087 CTGTGTGAACGCAGGGAAACCGG - Intronic
1135630948 16:24035308-24035330 CTGTCTCAAAGGAGGGAAACAGG + Intronic
1135951013 16:26914116-26914138 CTGAGTGAATGGTGGGAGAACGG + Intergenic
1137977047 16:53040906-53040928 GTGGATGGATGGAGGGATAATGG + Intergenic
1138226349 16:55298723-55298745 CTGTGAGAATAGAGGGCAAAGGG - Intergenic
1138753873 16:59458444-59458466 CTTTTGGAATGGAAGGAAAAAGG - Intergenic
1138777618 16:59743241-59743263 CTATACTATTGGAGGGAAAATGG - Intronic
1138916200 16:61467619-61467641 CTGTATGTATTTAGGGGAAATGG + Intergenic
1141657925 16:85426008-85426030 CTCTAAGAATGAATGGAAAATGG + Intergenic
1141932458 16:87215249-87215271 CTGTATAACTGAGGGGAAAAAGG - Intronic
1142275197 16:89114728-89114750 CTGTATGACTGGGGAGACAATGG + Intronic
1143301240 17:5912083-5912105 ATGGATGAATGGATGGAAGATGG - Intronic
1143301246 17:5912118-5912140 ATGGATGAATGGATGGAAGATGG - Intronic
1143322595 17:6077818-6077840 CTGTATAACTGAAGGGAAGAGGG - Intronic
1146552836 17:33796740-33796762 AAGTATGAAGTGAGGGAAAAAGG + Intronic
1146555095 17:33816292-33816314 GAAGATGAATGGAGGGAAAAAGG + Intronic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1156493258 18:37508874-37508896 CTGTATGCTTGGAGAGAGAAGGG + Intronic
1156708968 18:39918702-39918724 CTGGCTTAAAGGAGGGAAAAAGG + Intergenic
1157009773 18:43633193-43633215 CAGTAAAAATGGAGAGAAAAGGG - Intergenic
1157332724 18:46715178-46715200 CTGCAGAAAAGGAGGGAAAAAGG - Intronic
1157598879 18:48880604-48880626 CTGTATGAATGGGGAGCAAGTGG + Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1157943563 18:51955077-51955099 CTGTGTAAAGGGAGGGAAAAGGG + Intergenic
1158813619 18:61067811-61067833 TTGTTTGAATACAGGGAAAAAGG - Intergenic
1159309345 18:66687428-66687450 CTCAAAGAAGGGAGGGAAAAAGG - Intergenic
1159605308 18:70468756-70468778 CTGCATGAACTGAGGGGAAAAGG + Intergenic
1159788452 18:72744542-72744564 ATGAATCCATGGAGGGAAAAGGG + Intronic
1161307350 19:3575406-3575428 CTGTCTGCCTGGAGGGAATAGGG + Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161633657 19:5373398-5373420 CTGGATGAATGGATGGCACATGG + Intergenic
1162247365 19:9413027-9413049 CTGTATGAATGTAGAGAATCTGG - Exonic
1162265166 19:9567210-9567232 CTGTATGCATGTAATGAAAATGG - Intronic
1162311573 19:9910873-9910895 GTGAATGGATGGAGAGAAAATGG + Intronic
1162607520 19:11721768-11721790 CTGTATGAATGTAAGGAATGTGG - Exonic
1163371453 19:16903491-16903513 CTGTGTGATTGGAGGGAATGGGG + Intronic
1163383662 19:16985765-16985787 GTGAATGAATGGAGGGAGAGAGG + Intronic
1164639652 19:29814650-29814672 CTGTATGTGAGCAGGGAAAAAGG - Intronic
1164806437 19:31120702-31120724 CTATCTGAAGGGGGGGAAAAAGG + Intergenic
1164829638 19:31310582-31310604 CAGAATGAATGCAGGGAAAGGGG + Intronic
1164908032 19:31983611-31983633 CTATGTGATGGGAGGGAAAAAGG + Intergenic
1165076595 19:33282925-33282947 GTGAATGAATGAAGGGCAAAAGG + Intergenic
1165691045 19:37863454-37863476 CAATATGAATGGAGGGGACAAGG - Intergenic
1165968228 19:39602879-39602901 GTGTGTGAATGGAGAGTAAAGGG + Intronic
1167277644 19:48548535-48548557 CTAGATGAATGGATGGAAAATGG + Intergenic
1167770857 19:51516481-51516503 AAGTATTAATGGAGGTAAAAGGG - Intergenic
1168581354 19:57558301-57558323 CTGGATGAATGCAGTGAGAAAGG + Intronic
925431053 2:3793577-3793599 TTGTATGAATGGAGGGGAAATGG + Intronic
925597581 2:5571151-5571173 CTGAGTGAACGGAGGGAAAGAGG - Intergenic
926453305 2:13034117-13034139 TATTATGGATGGAGGGAAAACGG + Intergenic
926620025 2:15039271-15039293 CTGAATGAATGAGTGGAAAATGG + Intergenic
926636558 2:15186055-15186077 ATGTATGTATGGAGAGAAAGAGG - Intronic
926872050 2:17431169-17431191 GTGTATAAAGGGAGGAAAAATGG - Intergenic
926997147 2:18748265-18748287 ATATAGTAATGGAGGGAAAAAGG - Intergenic
927505168 2:23608150-23608172 CAGCATGATGGGAGGGAAAAAGG + Intronic
927550305 2:23992371-23992393 AAGTATGATTGGAGGGCAAAAGG + Intronic
927722531 2:25394739-25394761 CGGTGTGAATGCAGTGAAAAAGG + Intronic
927964223 2:27259122-27259144 CTCTGTGTATGGAAGGAAAAGGG - Intronic
928456084 2:31423808-31423830 TGGTATGAATGGATGAAAAAGGG - Intergenic
932524727 2:72452496-72452518 GGGTATGAATTGTGGGAAAAAGG + Intronic
932852674 2:75201492-75201514 CTGTACTAATGGAGGATAAATGG - Intergenic
933128446 2:78641937-78641959 TTTTATGAAAGGCGGGAAAATGG - Intergenic
933366989 2:81365406-81365428 TTATATGAATTGAGGGATAATGG + Intergenic
933563806 2:83924185-83924207 ATGAATGAATGGAGGGATGATGG - Intergenic
933582033 2:84138289-84138311 CTGTATGCAAGGAGAGATAATGG + Intergenic
933866856 2:86527362-86527384 CTTTATTCATAGAGGGAAAAAGG + Intronic
934033925 2:88072536-88072558 ATTTCAGAATGGAGGGAAAATGG + Intronic
934099535 2:88640276-88640298 CTTTTTAAATGGAGGGAAAATGG + Intergenic
934488006 2:94735928-94735950 CTGAATCCATGGAGAGAAAAAGG - Intergenic
935637136 2:105257998-105258020 ATGAATGAATGAATGGAAAATGG + Intergenic
936370162 2:111897123-111897145 CTGTATGCTTGGAGGGAAGCGGG - Intergenic
937170732 2:119864747-119864769 CAGAATGAATGTAGGGAAACAGG + Intronic
937880372 2:126859863-126859885 CTGTATGCATGGAGGGGAGGTGG + Intergenic
939054226 2:137343988-137344010 ATTTCTGAATGGAGAGAAAAAGG + Intronic
939302869 2:140368957-140368979 AGGTGTGAATGGAGGGGAAAGGG + Intronic
940187320 2:151001372-151001394 CTAGATGAGTGGAGAGAAAATGG - Exonic
940470911 2:154099053-154099075 TGGTATGAATGCAGAGAAAATGG - Intronic
940676523 2:156730404-156730426 CTGAATGAATGAAAGAAAAAAGG - Intergenic
941115694 2:161469744-161469766 CTGAATAGAAGGAGGGAAAATGG + Intronic
941329060 2:164154797-164154819 CTGTATGAATTTAAGGAGAAAGG + Intergenic
941725177 2:168852742-168852764 CTGTCTGAAGGGTGGGGAAAGGG - Intronic
942033335 2:171986190-171986212 GTGTGAGAAGGGAGGGAAAAAGG + Intronic
942785234 2:179693328-179693350 CTGAATGACTGAAGGGAGAAGGG + Intronic
943354493 2:186835029-186835051 CTGTAAGAATGTAGAGAAAGAGG - Intronic
944121810 2:196248542-196248564 CTGTAGGAAAGGTGGGGAAAGGG + Intronic
945765134 2:213966863-213966885 CTTAATGAATGGAGGAACAAAGG - Intronic
945972369 2:216243254-216243276 CTGCATGAATGGAGTGATAGGGG - Intergenic
1169174975 20:3502979-3503001 CAGTATCACTGGAGTGAAAAAGG - Intronic
1169545141 20:6642296-6642318 TTTTCAGAATGGAGGGAAAAGGG + Intergenic
1169570006 20:6896010-6896032 ATTTATGAAGGTAGGGAAAATGG + Intergenic
1169773479 20:9226632-9226654 CTATAGGAAAGGAAGGAAAATGG - Intronic
1170168625 20:13386583-13386605 CTGGATGGAAGGAGGGAAGAAGG - Intergenic
1170914142 20:20606149-20606171 CTGTGAAAATGGAAGGAAAAGGG - Intronic
1171127239 20:22613221-22613243 ATATATGAATTGAGGGTAAAGGG + Intergenic
1171150567 20:22823423-22823445 CAGCCTGAATGGAGGGACAAAGG - Intergenic
1172544655 20:35750278-35750300 TTGGATGAATGGATGGACAAAGG - Intergenic
1172783316 20:37450184-37450206 ATGGATGAATGGATGGACAAAGG - Intergenic
1173074853 20:39808025-39808047 CTGTAGGAAAGAGGGGAAAATGG - Intergenic
1174291180 20:49509840-49509862 CTGCAGGGATTGAGGGAAAAGGG - Intronic
1174392913 20:50228904-50228926 CTGGTTGGATAGAGGGAAAAAGG - Intergenic
1174916959 20:54663784-54663806 AAGTATGAATGGAGGACAAAAGG + Intergenic
1175221172 20:57417361-57417383 ATGTATGGATGGAGGGTGAATGG + Intergenic
1176292364 21:5052862-5052884 ATGGATGAATGGAGGGAAGGAGG - Intergenic
1176668279 21:9707674-9707696 TTCTGTGCATGGAGGGAAAAAGG + Intergenic
1176839273 21:13825721-13825743 CTGAATCCATGGAGAGAAAAAGG - Intergenic
1177127900 21:17218556-17218578 CTGCATAAATGAAGGAAAAATGG + Intergenic
1177831931 21:26148749-26148771 CTGGATGAATGAGGGAAAAATGG - Intronic
1177851734 21:26357197-26357219 CTGAATGAATGAATGGGAAAGGG + Intergenic
1178478459 21:32957925-32957947 ATGTTTGAATGGCAGGAAAAAGG + Intergenic
1179864893 21:44210788-44210810 ATGGATGAATGGAGGGAAGGAGG + Intergenic
1180148629 21:45936130-45936152 TTGTATGAAAGGAAGGAACAGGG - Intronic
1180255085 21:46621432-46621454 CTGAATGGATGAAGGGAGAAGGG - Intergenic
1181835602 22:25605497-25605519 CTCTGAGAGTGGAGGGAAAAAGG + Intronic
1182266345 22:29118765-29118787 GTGTATGAATGTATGGGAAAAGG - Intronic
1183106491 22:35618796-35618818 ATGGATGAATGGAGGGATGATGG - Intronic
1183340984 22:37281365-37281387 ATGAATGAATGAAGGGAACATGG - Intergenic
1184460202 22:44633529-44633551 CTGGATGAATGCATGGAAAATGG + Intergenic
1184991045 22:48170278-48170300 ATGAATGAATGGATGGAAAGAGG - Intergenic
949124526 3:430873-430895 TTCTAGAAATGGAGGGAAAATGG - Intergenic
950260188 3:11537785-11537807 CTGTATGGTTGGTGGTAAAATGG + Intronic
950456759 3:13097332-13097354 CTGGAAGCAGGGAGGGAAAAAGG - Intergenic
950515473 3:13462122-13462144 TAGTCTGAATGGAGGGAACAAGG + Intergenic
950526863 3:13529348-13529370 CAGGAGGGATGGAGGGAAAAGGG - Intergenic
950744658 3:15077564-15077586 CTGTATGTCTGGATGGACAAAGG + Intronic
951196769 3:19832513-19832535 TTTTATGAATGCTGGGAAAACGG - Intergenic
951327377 3:21319444-21319466 CTGAATAAATGTAGGAAAAACGG - Intergenic
951707701 3:25559806-25559828 GTGGATCAATGGATGGAAAATGG + Intronic
952245035 3:31578689-31578711 CTGCATGCATGGAAGGAGAAAGG - Intronic
952988666 3:38811814-38811836 CAGTATGAGAGGAGGAAAAAGGG - Intergenic
954886043 3:53874815-53874837 CAGAATGAATGGATGGAAGAAGG + Intronic
957080555 3:75632587-75632609 CTGTTTGAATGCAGAGAAAGTGG - Intergenic
958029921 3:88096277-88096299 CTCTAGAAATGGAGGGACAAAGG + Intronic
958136883 3:89505250-89505272 CTGTTTGAATGAAGGTAAGATGG + Intergenic
958955666 3:100463655-100463677 ATGAATGAAATGAGGGAAAAGGG + Intergenic
958962626 3:100524454-100524476 ATGTATGAAGGCAGGGGAAAGGG - Intronic
960981828 3:123236037-123236059 CTAGAGGAATGGAGGGAAATAGG + Intronic
962031928 3:131610105-131610127 ATTTGTGAAAGGAGGGAAAAAGG - Intronic
962643057 3:137408204-137408226 TGGTAGAAATGGAGGGAAAAAGG + Intergenic
962897346 3:139728312-139728334 CTGTGAGAAAGCAGGGAAAATGG + Intergenic
963284232 3:143417515-143417537 AGGGATGGATGGAGGGAAAAAGG + Intronic
963284240 3:143417539-143417561 ATGGATGGAGGGAGGGAAAAAGG + Intronic
963512501 3:146266009-146266031 CTGTGTGAATATAAGGAAAATGG + Intergenic
964234737 3:154512108-154512130 CTGTATCAAAGCAGTGAAAAAGG + Intergenic
964761456 3:160138265-160138287 CTGTTTGAATGGAGGGTAACTGG + Intergenic
964814051 3:160697701-160697723 CAGTATGAGTAGAGTGAAAATGG + Intergenic
966114151 3:176441328-176441350 TAGTATGAATAGATGGAAAATGG + Intergenic
966227495 3:177613728-177613750 CTGTGTGAATGCAGGTAACAGGG - Intergenic
966377904 3:179315766-179315788 TTGTATGAATGAAGGACAAAAGG - Intergenic
967038259 3:185664496-185664518 GTGAATTAATGGAGGGAGAAGGG + Intronic
967206518 3:187127605-187127627 CTGTATGATTGAATGGGAAAGGG - Intronic
967475016 3:189906574-189906596 CTGTATGAAGGCAGAGAAACTGG - Intergenic
967494982 3:190133079-190133101 CTGTGTGGTTGCAGGGAAAAAGG - Intergenic
967787188 3:193510000-193510022 ATGCATGAATGGAGGGGAGAAGG + Intronic
968148562 3:196319622-196319644 CTGAAAGAATGGAGGCAAGAAGG + Intronic
969082734 4:4632340-4632362 CTGTAGGAGAAGAGGGAAAAGGG - Intergenic
969198021 4:5578651-5578673 GTGGATGGAGGGAGGGAAAAGGG + Intronic
969894825 4:10293633-10293655 CTGTATGAAGTGGGGAAAAATGG - Intergenic
970548015 4:17149208-17149230 CTGTATCAGTAGAGTGAAAATGG + Intergenic
970773398 4:19642545-19642567 TGGTAAGGATGGAGGGAAAAGGG - Intergenic
970955311 4:21803883-21803905 CTTTATGTTTGGAGGTAAAATGG - Intronic
971110302 4:23577721-23577743 ATGTATAAATAGAGGGGAAAAGG - Intergenic
976378523 4:84373323-84373345 TGGTATGAATGGATGAAAAAGGG + Intergenic
976593192 4:86869816-86869838 CAGCAAGAATGGAGGGAAAAAGG - Intergenic
976614453 4:87062104-87062126 CTGTATGAGTGATGAGAAAATGG + Intronic
976669240 4:87633635-87633657 ATGTGTGAAGGGAGGAAAAAGGG - Intergenic
978164699 4:105592756-105592778 CTTTATGAAATGATGGAAAAGGG - Intronic
978742913 4:112158960-112158982 ATGTATGTATGGGGGGAAAAGGG - Intronic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
979092010 4:116495272-116495294 GCCTATGAATGGAGAGAAAAAGG + Intergenic
979799876 4:124895038-124895060 CTGTATTAGTGGAGGCAAAATGG + Intergenic
980466600 4:133194082-133194104 CTGTATGAATGCAGGTAGATGGG + Exonic
980888669 4:138790500-138790522 CTGTCTGAATTGCTGGAAAATGG + Intergenic
981207519 4:142060828-142060850 CTGTACAACTGGAAGGAAAAAGG + Intronic
981404884 4:144356488-144356510 CTGTCTGAATGGTGCTAAAAAGG - Intergenic
981521063 4:145663005-145663027 CTTTAAGAATGGAGGCAATAAGG + Intergenic
981775405 4:148361712-148361734 TTGTAAGAATGGAAGGAGAAGGG - Intronic
982099911 4:151957759-151957781 CTTGCAGAATGGAGGGAAAAGGG - Intergenic
982666310 4:158268905-158268927 CTTTATGAAAGTAGGGAAGATGG - Intergenic
983167013 4:164490353-164490375 TTGTATGAAGGGAGTGAAACCGG - Intergenic
983622127 4:169772920-169772942 CTGAATGAATGGATGGATGAAGG - Intergenic
983806059 4:171993731-171993753 CAGTATGAAAGAAGGCAAAAAGG + Intronic
984624035 4:181985917-181985939 ATGTATGAAAGAGGGGAAAAAGG - Intergenic
985179236 4:187238485-187238507 CTGGATGAATGGAGGGTGTAGGG - Intergenic
985406502 4:189643817-189643839 TTCTGTGCATGGAGGGAAAAAGG - Intergenic
985525513 5:399487-399509 CTCTGTGACTGGAGGGCAAATGG - Intronic
985824853 5:2184622-2184644 TTATAGGAATGGATGGAAAAGGG + Intergenic
988051592 5:26038020-26038042 CTGTATTAATGAAGGGCAATGGG - Intergenic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
992529508 5:77640997-77641019 CTGTCTGGAGGGAGGGAGAAGGG + Intergenic
993331130 5:86601593-86601615 CTGTAAGAATGTGGAGAAAAGGG + Intergenic
995173460 5:109144678-109144700 CTCCAAGAATGGAGGGAAACTGG - Intronic
995385563 5:111585092-111585114 CTGTGAGAATGCAGGGAAATAGG + Intergenic
996470636 5:123856077-123856099 CTGGAAGAATGGTGGGAATAAGG - Intergenic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
997639938 5:135442546-135442568 CTGTAAGGATGGAGGGAGGAGGG - Intergenic
997896689 5:137725044-137725066 TGGAATGAATGGAGGGAAAAAGG - Intronic
999523451 5:152376934-152376956 CTGTATGGATGGGGACAAAATGG + Intergenic
999742467 5:154566624-154566646 CTGTATGGAAGGAGGGAACTTGG - Intergenic
1000133313 5:158320647-158320669 ATGTATGAATTGAGAGAGAAAGG - Intergenic
1000370478 5:160530769-160530791 CAGAATCAATGGAGTGAAAAGGG - Intergenic
1000692796 5:164343984-164344006 ATATATGATTGAAGGGAAAAAGG + Intergenic
1001873948 5:175183016-175183038 CTGGATGAAAGGAGCAAAAAAGG + Intergenic
1002915296 6:1524003-1524025 CTGTGTGAATGCAGGGAAAGCGG + Intergenic
1003146134 6:3512104-3512126 CTCTAGGAATGGAGGCAAAGTGG - Intergenic
1003520586 6:6855434-6855456 TTGAATGAATGGATGGAAAATGG - Intergenic
1003731511 6:8829804-8829826 CTGTAGGACTGGATGGACAAAGG + Intergenic
1005891011 6:30137974-30137996 GACTATGAATGGAGGGAGAAAGG - Intronic
1006237061 6:32642816-32642838 CAGTATGAAAGGAAGGAAAGTGG + Intronic
1006265236 6:32916062-32916084 CTCTAATAATGGAGGAAAAAGGG + Intergenic
1006960962 6:37929578-37929600 CTGTATGAAAAGAGGGAATGTGG + Intronic
1007155113 6:39735296-39735318 CAGTTTGATTGGAGGGAAAGGGG - Intergenic
1007313142 6:40962646-40962668 CTGCATGAATTCAGGGAAACTGG - Intergenic
1007934680 6:45722427-45722449 CTGTATGCATGAAGGAAAAGTGG + Intergenic
1008513447 6:52298365-52298387 CTGTATGAATGGAAACAAGAGGG - Intergenic
1008741163 6:54610117-54610139 ATGAATGAATGGAGGGATCAAGG - Intergenic
1009553081 6:65125206-65125228 TTGAATAAATGAAGGGAAAAAGG - Intronic
1009822334 6:68819225-68819247 CAGTTTCAATGGAGTGAAAAGGG - Intronic
1012515048 6:100049512-100049534 ATGGATGGATGGAGGGAAGAGGG + Intergenic
1012623271 6:101375574-101375596 CTTTGTGATTGGAGGCAAAATGG + Intergenic
1013608022 6:111768570-111768592 CCGAATGAATGGAGGGACAGTGG + Intronic
1014391008 6:120864356-120864378 TTGTAAGAATGGGGAGAAAAGGG + Intergenic
1014762700 6:125375145-125375167 AGGAATGAATGGAGAGAAAAAGG - Intergenic
1014808998 6:125864413-125864435 CTCTCTGATTGGAGGGAAAATGG + Intronic
1014997321 6:128165332-128165354 CTGTATGTAAAGAGGAAAAAGGG - Intronic
1015047902 6:128799999-128800021 CTGTATGAATTTTGGTAAAATGG - Intergenic
1015053076 6:128865419-128865441 ATGTATCAATTGAGGGAAAAAGG - Intergenic
1015164150 6:130184752-130184774 ATGGATGAATGGATGGAAGATGG - Intronic
1016446078 6:144133247-144133269 CAGTGTGAATGGAGGGAAAGTGG - Intergenic
1016508553 6:144813516-144813538 CTTTACCAATGGAAGGAAAATGG - Intronic
1016508668 6:144814665-144814687 CTTTATGAATGGGAGGAAAATGG + Intronic
1016718905 6:147269785-147269807 GTGAAAGAATGGAGGAAAAAAGG + Intronic
1017263411 6:152414441-152414463 CTGTAAGAATGAAGAGTAAATGG - Intronic
1017523359 6:155221482-155221504 CTGTTTCAATGGAGAGAAAAAGG - Intronic
1017732058 6:157325337-157325359 ATGTATGAGGGGAAGGAAAAAGG - Intergenic
1017954253 6:159165363-159165385 TTCTATGAACAGAGGGAAAAGGG - Intergenic
1018346600 6:162905292-162905314 CTGTGTGAATGGAGTGGGAAGGG + Intronic
1018625141 6:165770906-165770928 CAGGATGAATGGGGGGACAATGG - Intronic
1018869618 6:167770869-167770891 CTGTCTGGATGGAGGGAAGTGGG - Intergenic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1021541630 7:21765781-21765803 CAGTATGTATGGTGGAAAAAAGG - Intronic
1022391714 7:29949677-29949699 CTGTCTGAAAGAAGGAAAAAAGG - Intronic
1023754962 7:43407798-43407820 CTCCATGAATGGAGGGAAGGAGG - Intronic
1026392565 7:69916693-69916715 ATGTAAGAATGGGGGGAAGAGGG - Intronic
1027767366 7:82362548-82362570 CTGCAGTAATGGAGGAAAAAAGG + Intronic
1027769996 7:82394314-82394336 CTAGATGAAGGGAGGGAAGAAGG + Intronic
1027887549 7:83928803-83928825 ATGTATGAATGAAGGTGAAAAGG + Intergenic
1028474078 7:91234721-91234743 TTTTATTAATGGAGGGAAATTGG - Intergenic
1030373209 7:108724152-108724174 CTGTCTGAAAGGAGGGGCAATGG - Intergenic
1033511595 7:142065214-142065236 CTGCGTGACTGGAGGGAACATGG - Intronic
1033514665 7:142094243-142094265 CTGCGTGATTGGAGGGAACACGG - Intronic
1033584461 7:142763749-142763771 CTGTATGAAGAGAGAGAAAGAGG - Intronic
1035278910 7:157765264-157765286 GTGGATGAATGGAGGAAGAATGG - Intronic
1035318768 7:158014690-158014712 ATGGATGAATGGAGGGACAGAGG - Intronic
1035576426 8:709824-709846 CTGTATGCATGGATGGATGATGG - Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037444949 8:18956090-18956112 CTGAATGAATGGAAGGAAGAAGG + Intronic
1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG + Intronic
1037921302 8:22808083-22808105 CTGAATGAATGGATGGATAGAGG - Intronic
1037951918 8:23024141-23024163 CAGCAGGAATGGAGGGAATAGGG - Intronic
1038007239 8:23442718-23442740 CTGAGTGAATGGAGGGATAAAGG - Intronic
1038510462 8:28129710-28129732 GGGTATGAATGTAGAGAAAATGG - Intronic
1038960193 8:32509897-32509919 CTGAATGAAAGGAGAGTAAAAGG - Intronic
1039855622 8:41410003-41410025 ATGTATGAATGTAAGAAAAATGG - Intergenic
1040843010 8:51804510-51804532 CTGTATTTATGGAGTAAAAAGGG - Intronic
1042745111 8:72098787-72098809 CTGAAAGAATGGAGGGAAGCTGG - Intronic
1043413402 8:80023889-80023911 TTTTAAAAATGGAGGGAAAATGG + Intronic
1043487724 8:80714897-80714919 TTGTATGCATGGAGGCAAAATGG - Intronic
1043730936 8:83680508-83680530 CTGTATGAACAGAAAGAAAAAGG + Intergenic
1043817448 8:84819064-84819086 CTCTATGTCTGCAGGGAAAAAGG + Intronic
1044003177 8:86910385-86910407 CTGTAACACTGGAGAGAAAAAGG + Intronic
1045409881 8:101906215-101906237 CTGTAAGAAGTGAGGGAAATGGG - Intronic
1045857360 8:106780067-106780089 CTGGAAGAATGAAGGGACAAGGG - Intergenic
1045982584 8:108208433-108208455 CTGTATGATTGGGAGGAAACAGG + Intronic
1046037977 8:108867102-108867124 CTATAGGAATTGAGGGAACATGG - Intergenic
1046783761 8:118243869-118243891 CTGCATGAAGAGAGAGAAAATGG + Intronic
1047197987 8:122738888-122738910 CTGTCTGAAGGGAGAGAAATTGG - Intergenic
1047960871 8:130010790-130010812 CTGAATGAATGAAGGGGAGAGGG + Intronic
1048553714 8:135456542-135456564 CTGTTTGAAGGCAGGAAAAATGG + Intergenic
1049870719 8:144973370-144973392 CTGTATGAAAAGAGGGGCAAAGG - Intergenic
1049912992 9:287731-287753 CTGAATAAATGGACTGAAAATGG - Intronic
1049941506 9:550359-550381 ATGTACGGATGCAGGGAAAAAGG - Intronic
1050396898 9:5207887-5207909 CTGTATAAAGGCAGGGAAAGTGG - Intergenic
1050945662 9:11513512-11513534 ATGTAGGAGGGGAGGGAAAATGG + Intergenic
1051870427 9:21731061-21731083 ATGCAGGAATGGAGAGAAAATGG - Intergenic
1052286418 9:26790897-26790919 CTGAATGAAAGAAGGAAAAAAGG - Intergenic
1052472488 9:28917380-28917402 CTGAATGGATGGGTGGAAAATGG - Intergenic
1053179924 9:35960135-35960157 CTGTATGAAGGGATGGGAAGAGG - Intergenic
1053669791 9:40348491-40348513 CTGAATCCATGGAGAGAAAAAGG + Intergenic
1053919588 9:42974746-42974768 CTGAATCCATGGAGAGAAAAAGG + Intergenic
1054514821 9:66027805-66027827 CTGAATCCATGGAGAGAAAAAGG - Intergenic
1054998017 9:71414403-71414425 CTTTGTGAAAGGAAGGAAAAAGG - Intronic
1055295115 9:74826082-74826104 CTGTACCAAAGGAGGGAAAAAGG + Intronic
1055696980 9:78895607-78895629 CCGCCTGAAGGGAGGGAAAAGGG + Intergenic
1057432844 9:95010718-95010740 AGGGATGAAGGGAGGGAAAACGG - Intronic
1059170231 9:112117788-112117810 CTGGTTGAATGGATGGATAAAGG + Intronic
1059542310 9:115143113-115143135 CTGTGTGAACACAGGGAAAAAGG + Intronic
1060010106 9:120036392-120036414 CTCTATGAAAGGTGGAAAAAAGG - Intergenic
1060037185 9:120265514-120265536 ATGGATGGATGGATGGAAAATGG + Intergenic
1203657587 Un_KI270753v1:13281-13303 TTCTGTGCATGGAGGGAAAAAGG - Intergenic
1185546998 X:953845-953867 CTGAATGAATGGATGGATGAGGG - Intergenic
1185547110 X:954450-954472 CTGGATGAATGGATGGATGAGGG - Intergenic
1185939341 X:4297989-4298011 CAGAAAGAATGAAGGGAAAAAGG - Intergenic
1186001900 X:5021914-5021936 ATGGATGAATGGATGGAAGATGG - Intergenic
1186093659 X:6077049-6077071 ATGTAGGAATGAAAGGAAAAAGG - Intronic
1187085515 X:16038965-16038987 AAGTATGAATGGAGGACAAAAGG - Intergenic
1187444219 X:19346198-19346220 CTCCATGAAGGGAGGGAGAAGGG + Intronic
1187495846 X:19794845-19794867 CTGAATGAATGGAAGGAGTAAGG - Intronic
1187550486 X:20298288-20298310 TTGGTTGAATGCAGGGAAAAGGG + Intergenic
1190447253 X:50538842-50538864 CAATATGAATGGAGAAAAAAAGG + Intergenic
1191152248 X:57232104-57232126 CTGTATAGATGGAGGGATGAAGG + Intergenic
1192146839 X:68688110-68688132 GTGTATGTATGGAGGGGAAAGGG + Intronic
1192264008 X:69526149-69526171 TTGTATGAATGGAATGAAAAGGG - Intronic
1192366074 X:70474457-70474479 CTGGTTGTATGCAGGGAAAAGGG + Intronic
1192795927 X:74423696-74423718 CTGCATCAAAGCAGGGAAAAAGG - Intronic
1193620249 X:83744415-83744437 TTGACTGAATGGATGGAAAAGGG - Intergenic
1195618733 X:106932797-106932819 CTGTTTGAATGGCTGGACAAAGG - Intronic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196340672 X:114592647-114592669 CTGTATTAATGGACTGAAATGGG - Intronic
1197056313 X:122124032-122124054 TGGTATGAATGGGGAGAAAAGGG + Intergenic
1197720090 X:129739171-129739193 CTGGGTGGATGGAGGGACAAGGG - Exonic
1198502291 X:137263305-137263327 CTGTAGGAATGGAAAGAAATTGG + Intergenic
1199916205 X:152343596-152343618 CTGTGTGAATGGAGAGAATTTGG - Intronic
1200781624 Y:7221469-7221491 ATGTATGAATAGATGTAAAATGG + Intergenic