ID: 992488023

View in Genome Browser
Species Human (GRCh38)
Location 5:77214378-77214400
Sequence CTGTATGAATGGAGGGAAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992488023_992488027 9 Left 992488023 5:77214378-77214400 CCGTTTTCCCTCCATTCATACAG No data
Right 992488027 5:77214410-77214432 ATTTGTTCATTCAGTATTTGTGG 0: 1
1: 0
2: 7
3: 73
4: 574
992488023_992488028 26 Left 992488023 5:77214378-77214400 CCGTTTTCCCTCCATTCATACAG No data
Right 992488028 5:77214427-77214449 TTGTGGCCAGACTGTGTTGTAGG 0: 1
1: 0
2: 0
3: 14
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992488023 Original CRISPR CTGTATGAATGGAGGGAAAA CGG (reversed) Intronic
No off target data available for this crispr