ID: 992488208

View in Genome Browser
Species Human (GRCh38)
Location 5:77215988-77216010
Sequence GTGACCAATCGGAGGGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992488208 Original CRISPR GTGACCAATCGGAGGGCTGT AGG Intronic
901338598 1:8473755-8473777 GTGACCCAGCTGAGGGCTGGTGG - Intronic
904444906 1:30562823-30562845 GTAACCAATTGGAGGCCTCTAGG + Intergenic
909853036 1:80493515-80493537 GGGACCACTTGGAGGGGTGTTGG + Intergenic
910867103 1:91798670-91798692 GTGACCTCTCTGAGGGCTGTGGG + Intronic
913483491 1:119312109-119312131 GTGACTGATCGGAGGACTGAGGG + Intergenic
920124329 1:203681641-203681663 GTGACAAAACGGAGGGCTGAAGG - Intronic
1063639163 10:7813872-7813894 GAGAGCAATCAGAGGGGTGTGGG + Intergenic
1076676590 10:132150129-132150151 GTGGCCCATGGCAGGGCTGTGGG - Intronic
1082810055 11:57474268-57474290 GTGGCCAAGAGGAGGGCTCTTGG + Intronic
1088047707 11:105473600-105473622 GTGACCAAGGGGAAGACTGTAGG + Intergenic
1090326635 11:125892714-125892736 GTGACCAATTAGGGGGCTGCTGG - Intronic
1094053151 12:26242551-26242573 GTGGCCAATGGGATGGCTCTGGG - Intronic
1135519208 16:23160792-23160814 ATGACCCATCTCAGGGCTGTGGG + Intergenic
1139384839 16:66560091-66560113 GTGCCCAAACTGAGGGCTGAAGG + Intronic
1142124631 16:88404029-88404051 CTGACCAGTCGGGGGGCTTTGGG - Intergenic
1146671524 17:34741235-34741257 GTGACAGATCTGAGGGCTGGGGG - Intergenic
1149551334 17:57542430-57542452 GTGACCAATGCTAAGGCTGTGGG - Intronic
1152431301 17:80249486-80249508 GTGACCCCTCGGAGGGCTGGGGG - Intronic
1154942844 18:21132027-21132049 TTGACCAATCAGTAGGCTGTGGG - Intergenic
1157260853 18:46174411-46174433 GGGGCGAATCGGAGGGCTGCGGG + Intronic
1158132428 18:54167534-54167556 GTGGCCACTCTGAGGGCTTTTGG + Intronic
1163378255 19:16947465-16947487 GTGAGGATACGGAGGGCTGTGGG - Intronic
1164356623 19:27441242-27441264 GTGAGCGCTTGGAGGGCTGTGGG + Intergenic
1164821882 19:31257003-31257025 CTGACCAATAGGACTGCTGTGGG - Intergenic
1165168723 19:33875661-33875683 GTGACCCCACGGAGAGCTGTGGG - Intergenic
1166217916 19:41348219-41348241 GTGACCAAGGGGGTGGCTGTGGG - Intronic
932797016 2:74704751-74704773 GTGACCATTCGGAGGGCAACTGG - Intergenic
935101490 2:99999934-99999956 CTGACCAAAGGGTGGGCTGTGGG - Intronic
935831804 2:107008123-107008145 GTGCCCATTCGCAGGGCTGGGGG + Intergenic
943965119 2:194322117-194322139 GTGGCCATTCAGAGGGTTGTGGG + Intergenic
944311510 2:198238850-198238872 GTGAGCAACTGGAGGGCTGGAGG + Intronic
1169315081 20:4583801-4583823 GGGGCCTATCGGAGGGCGGTGGG + Intergenic
1179389050 21:40970689-40970711 GTGCCTAATGGGAGGGCTTTGGG + Intergenic
1180036473 21:45252815-45252837 GTGTGCAATGGGAGGGGTGTCGG + Intergenic
1181868801 22:25881477-25881499 GTGAAAAATTGGAGAGCTGTGGG + Intronic
1182441666 22:30368166-30368188 GTTACCACTCTGAGGGCTGGAGG + Intronic
950944898 3:16934833-16934855 GTGAACAACCAGAGGGCTGAGGG - Intronic
953806957 3:46078775-46078797 TTGACCAATTGGAGTGCTCTAGG + Intergenic
968232076 3:197010160-197010182 GTGAGCAATCTCTGGGCTGTAGG - Intronic
968423821 4:507514-507536 CTGCCCAATCAGGGGGCTGTTGG - Exonic
970320217 4:14867915-14867937 GGGACCAACTGCAGGGCTGTGGG - Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
982043951 4:151423052-151423074 CTGAGCAATTGGAGAGCTGTAGG + Intronic
983872233 4:172835679-172835701 CTGACCAATCGGAGTGCATTCGG - Intronic
986280370 5:6317154-6317176 CTGACCAATCAAAGGGCTCTAGG - Intergenic
992488208 5:77215988-77216010 GTGACCAATCGGAGGGCTGTAGG + Intronic
1019435994 7:1022342-1022364 GTGCCCCATGAGAGGGCTGTGGG - Intronic
1021565710 7:22014467-22014489 ATGAGCAGTGGGAGGGCTGTTGG + Intergenic
1023632679 7:42179545-42179567 GTGAGGAAACTGAGGGCTGTTGG + Intronic
1024772745 7:52743711-52743733 CTGACCCATGTGAGGGCTGTGGG - Intergenic
1035283589 7:157792722-157792744 GTGGCCCATCTGCGGGCTGTAGG - Intronic
1053023151 9:34709477-34709499 GTGAGGAATCTGAGGGATGTGGG - Intronic
1061147268 9:128807443-128807465 GTGGCCACTCACAGGGCTGTTGG + Intronic
1190105252 X:47556174-47556196 GTGGCCAATGGGAGGTGTGTGGG - Intergenic