ID: 992496776

View in Genome Browser
Species Human (GRCh38)
Location 5:77301421-77301443
Sequence TACATGAAGTTGGGAGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 534}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992496776_992496781 -7 Left 992496776 5:77301421-77301443 CCACTTTCTCCCAACTTCATGTA 0: 1
1: 0
2: 3
3: 23
4: 534
Right 992496781 5:77301437-77301459 TCATGTAATGTTCAGGAGAAGGG No data
992496776_992496784 14 Left 992496776 5:77301421-77301443 CCACTTTCTCCCAACTTCATGTA 0: 1
1: 0
2: 3
3: 23
4: 534
Right 992496784 5:77301458-77301480 GGAAGGCATCAGAGGCATGCAGG 0: 1
1: 0
2: 2
3: 24
4: 358
992496776_992496786 21 Left 992496776 5:77301421-77301443 CCACTTTCTCCCAACTTCATGTA 0: 1
1: 0
2: 3
3: 23
4: 534
Right 992496786 5:77301465-77301487 ATCAGAGGCATGCAGGAGGATGG 0: 1
1: 0
2: 7
3: 41
4: 394
992496776_992496785 17 Left 992496776 5:77301421-77301443 CCACTTTCTCCCAACTTCATGTA 0: 1
1: 0
2: 3
3: 23
4: 534
Right 992496785 5:77301461-77301483 AGGCATCAGAGGCATGCAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 312
992496776_992496788 27 Left 992496776 5:77301421-77301443 CCACTTTCTCCCAACTTCATGTA 0: 1
1: 0
2: 3
3: 23
4: 534
Right 992496788 5:77301471-77301493 GGCATGCAGGAGGATGGAGGTGG 0: 1
1: 0
2: 6
3: 92
4: 813
992496776_992496783 6 Left 992496776 5:77301421-77301443 CCACTTTCTCCCAACTTCATGTA 0: 1
1: 0
2: 3
3: 23
4: 534
Right 992496783 5:77301450-77301472 AGGAGAAGGGAAGGCATCAGAGG 0: 1
1: 0
2: 4
3: 97
4: 768
992496776_992496780 -8 Left 992496776 5:77301421-77301443 CCACTTTCTCCCAACTTCATGTA 0: 1
1: 0
2: 3
3: 23
4: 534
Right 992496780 5:77301436-77301458 TTCATGTAATGTTCAGGAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 203
992496776_992496782 -3 Left 992496776 5:77301421-77301443 CCACTTTCTCCCAACTTCATGTA 0: 1
1: 0
2: 3
3: 23
4: 534
Right 992496782 5:77301441-77301463 GTAATGTTCAGGAGAAGGGAAGG 0: 1
1: 0
2: 2
3: 24
4: 254
992496776_992496787 24 Left 992496776 5:77301421-77301443 CCACTTTCTCCCAACTTCATGTA 0: 1
1: 0
2: 3
3: 23
4: 534
Right 992496787 5:77301468-77301490 AGAGGCATGCAGGAGGATGGAGG 0: 1
1: 0
2: 6
3: 67
4: 567

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992496776 Original CRISPR TACATGAAGTTGGGAGAAAG TGG (reversed) Intronic
900430419 1:2598798-2598820 TAGAGGAAGTGGGGAGAAAGAGG + Intronic
901474592 1:9480842-9480864 TACATGAAGCTGGGAGACAGAGG - Intergenic
902161609 1:14535033-14535055 TCCTTGAAGAAGGGAGAAAGGGG - Intergenic
902369331 1:15995796-15995818 TACAAGAAGTTAGGCAAAAGAGG - Intergenic
902441385 1:16432450-16432472 AACATGAGGTTGGATGAAAGAGG - Intronic
902593465 1:17491707-17491729 CACTTGAACTTGGGAGACAGAGG - Intergenic
902887763 1:19418547-19418569 TTCAGGAAGTGGGAAGAAAGAGG - Intronic
903347065 1:22693303-22693325 CACATGAACTTGGGAGGCAGAGG + Intergenic
903347461 1:22695934-22695956 TACTTGAACCTGGGAGACAGAGG + Intergenic
903755876 1:25660315-25660337 CACTTGAACTTGGGAGACAGAGG + Intronic
903777603 1:25802801-25802823 CACAAGAAGTTGGAAGAAAATGG - Intronic
904257950 1:29268558-29268580 TAAATGTAGATGGAAGAAAGAGG + Intronic
904328392 1:29742379-29742401 TAGATGAACCTGGGAGAGAGAGG + Intergenic
904797830 1:33070630-33070652 TACATGTAGGTGTGAGAGAGAGG + Intronic
904842984 1:33385878-33385900 TGCATGAACCTGGGAGACAGAGG - Intronic
905144797 1:35879649-35879671 TGCTTGAAGTTGGGAGGCAGAGG + Intronic
905585318 1:39112592-39112614 TACTTGAACCTGGGAGACAGAGG + Intronic
906213998 1:44028669-44028691 TGCTTGAACTTGGGAGACAGAGG + Intronic
906783157 1:48590470-48590492 TACTTGATCTTGGGAGATAGAGG + Intronic
907800014 1:57755260-57755282 TAAATCAACTTGGGAAAAAGTGG + Intronic
908090000 1:60675994-60676016 TAAATGATGTTGGGGGTAAGGGG + Intergenic
908760924 1:67511192-67511214 TACTTGAACTTGGGAGGCAGAGG - Intergenic
910276594 1:85456024-85456046 GATAAGAAGATGGGAGAAAGTGG - Intronic
911908918 1:103606440-103606462 TGCTTGAACTTGGGAGACAGAGG + Intergenic
911914001 1:103673021-103673043 TGCTTGAACTTGGGAGACAGAGG - Intronic
912193414 1:107368110-107368132 GACATGAAGATAGAAGAAAGGGG - Intronic
912558864 1:110535900-110535922 GAGATGTAGTTGGGAGAGAGGGG + Intergenic
914885720 1:151582788-151582810 TATATGTTGTTTGGAGAAAGAGG + Exonic
915615928 1:157038338-157038360 GACATGAATATGTGAGAAAGGGG - Intronic
916925141 1:169511323-169511345 TATATGAACTTGGGAGAATTAGG + Intergenic
916994849 1:170285415-170285437 TACAGGAAGTCGGAAGAGAGAGG + Intergenic
917507475 1:175641120-175641142 TACATGAAATTTGGAGAAATTGG + Intronic
918234571 1:182567924-182567946 TACCAGAAGTTGGGAGACTGAGG + Intergenic
918626795 1:186664718-186664740 AACATGAATTTTGGAGAGAGAGG + Intergenic
918825023 1:189313415-189313437 GACAGGAAGCTGGGATAAAGGGG - Intergenic
918954806 1:191192558-191192580 TACTTGAACCTGGGAGACAGAGG + Intergenic
919717052 1:200789734-200789756 TAGATCAAGTTGGGAAAAACCGG + Intronic
919989589 1:202700104-202700126 TTCTTGGAGTTGGGAGAGAGGGG - Intronic
920076168 1:203338520-203338542 AAAAGGAAGTTGGGAAAAAGTGG + Intergenic
920745580 1:208624894-208624916 GACATGACCTTGGAAGAAAGAGG + Intergenic
920854158 1:209650011-209650033 TAGATGAAGCTCGGAGAAACCGG + Exonic
920956104 1:210621475-210621497 GAGAGGAAGTTGGGAGACAGAGG - Intronic
922231997 1:223695523-223695545 GACACGAAGTTGGGAGAAAAGGG + Intergenic
923005260 1:230044462-230044484 TACTTGAACTTGGGAGGCAGAGG + Intergenic
923131880 1:231082504-231082526 CACTTGAACTTGGGAGACAGAGG - Intergenic
923360909 1:233210359-233210381 GACTTGAACTTGGGAGATAGAGG - Intronic
923391720 1:233519242-233519264 TAGATGAAGGTGGTAGAAATGGG - Intergenic
1063069122 10:2641680-2641702 CACCTGAACTTGGGAGATAGAGG + Intergenic
1063335228 10:5206260-5206282 TCCATGACCTGGGGAGAAAGGGG - Exonic
1063408621 10:5819391-5819413 TGCTTGAACTTGGGAGAAGGAGG - Intronic
1065764313 10:29012879-29012901 CACATGAAGCTGGGAGGCAGAGG - Intergenic
1065831299 10:29616804-29616826 TACTTGAACTTGGGAGGCAGAGG - Intronic
1066161259 10:32732739-32732761 TACATGTAGGTGGGGGAAGGTGG - Intronic
1066640067 10:37547039-37547061 TACATGAATCTGGGAGGCAGTGG - Intergenic
1067347455 10:45446794-45446816 TGCATGAACCTGGGAGACAGAGG + Intergenic
1067841350 10:49681891-49681913 TATATGAAGTTGGGGGAAGGGGG + Intronic
1068854690 10:61785418-61785440 TACATGAAGTTTGCAGTGAGAGG - Intergenic
1069009311 10:63353597-63353619 CACTTGAACTTGGGAGGAAGAGG - Intronic
1069980179 10:72247092-72247114 TACTTGAACTTGGGAGGCAGAGG - Intergenic
1070724774 10:78780463-78780485 TTCCCGAAGCTGGGAGAAAGTGG + Intergenic
1070753304 10:78976532-78976554 TCCAAGAGGTTGGGAGAGAGGGG - Intergenic
1071273843 10:84034733-84034755 GACATGCAGTTGGCTGAAAGTGG - Intergenic
1072292058 10:93973215-93973237 TACATGAGGTTGTGAGGATGGGG - Intergenic
1073016114 10:100400675-100400697 TACTTGAACTTGGGAGGCAGAGG - Intergenic
1073250646 10:102118793-102118815 TACACCAAGCTGGTAGAAAGAGG + Intronic
1073997321 10:109330390-109330412 TACATGTTGTTGGGTGGAAGTGG - Intergenic
1074246961 10:111703934-111703956 TACATAAAGGTGGCAGGAAGAGG - Intergenic
1074405657 10:113178366-113178388 CAGATGAATTTGTGAGAAAGAGG + Intergenic
1075036636 10:119074832-119074854 TACATGAACCTGGGAGGCAGAGG + Intronic
1075855570 10:125626657-125626679 GCCATGAAGTGGGGAGAAGGAGG + Intronic
1077893250 11:6434853-6434875 ATCATGAAGTAGTGAGAAAGTGG + Intronic
1078313727 11:10272984-10273006 TACTTGAACCTGGGAGACAGAGG + Intronic
1078416896 11:11173388-11173410 TGCATGATCTTGGGAGATAGAGG - Intergenic
1079033088 11:17000165-17000187 TGCATGAACCTGGGAGACAGAGG - Intronic
1079200215 11:18370669-18370691 TACAAGAATTTGGCAGAAATAGG - Intergenic
1079224304 11:18591929-18591951 TGCTTGAAGTTGGGAGGCAGAGG + Intergenic
1079983627 11:27177710-27177732 TGCATGACGTAGGGAGAAGGTGG - Intergenic
1080397377 11:31902633-31902655 AGCTTGAAGTGGGGAGAAAGAGG + Intronic
1080599909 11:33811069-33811091 TGCATGAACATAGGAGAAAGTGG - Intergenic
1081365429 11:42229520-42229542 GAGATGGAGTTGGGGGAAAGTGG + Intergenic
1083876288 11:65525838-65525860 GACTTGAAGTTGGGAGAGATGGG - Intronic
1085106112 11:73844345-73844367 TACTTGAACTGGGGAGGAAGAGG + Intronic
1087774298 11:102243421-102243443 TGCTTGAACTTGGGAGACAGAGG + Intergenic
1088584760 11:111352848-111352870 CACTTGAACTTGGGAGACAGAGG + Exonic
1089477870 11:118780399-118780421 TACTTGAACTTGGGAGGCAGAGG - Intronic
1089481023 11:118805167-118805189 TCCATGAAGTTTGGATAAATTGG - Intergenic
1089544823 11:119215741-119215763 TGCTTGAACTTGGGAGATAGAGG + Intronic
1089868529 11:121652354-121652376 GGCATGAAGTGGGGAGAAAGGGG - Intergenic
1090944803 11:131420270-131420292 GACCTGATGATGGGAGAAAGAGG + Intronic
1091311666 11:134579454-134579476 TGCATGAAGACGGCAGAAAGGGG + Intergenic
1091918813 12:4288337-4288359 TACAAGGAGATGGGAGAAACGGG - Intronic
1092013234 12:5134363-5134385 TAGATGAAGTTGAGAGAACAGGG + Intergenic
1092112767 12:5975663-5975685 TACATGAGGGTGGAAGAAAAAGG + Intronic
1093258809 12:16907534-16907556 TTGAAGAAGCTGGGAGAAAGGGG - Intergenic
1094008291 12:25779461-25779483 CACATGGAGCTGTGAGAAAGGGG + Intergenic
1094020564 12:25909660-25909682 TGCTTGAACTTGGGAGGAAGAGG - Intergenic
1094372619 12:29754330-29754352 TACATGAAGAAGAAAGAAAGAGG + Intronic
1095628131 12:44342376-44342398 GACATGACCTTGGGAGAAGGTGG + Intronic
1096185257 12:49575632-49575654 TGCTTGAACTTGGGAGACAGAGG + Intronic
1096194888 12:49643371-49643393 TCCAAGAAGATGGGAGGAAGGGG - Exonic
1096206235 12:49724249-49724271 TACTTGAACCTGGGAGAAGGAGG + Intronic
1096860114 12:54520233-54520255 TACATGAAGTTGAGAGGACATGG + Intronic
1098061117 12:66564003-66564025 TTCATGAAGTTGGAAGATATTGG - Intronic
1098253576 12:68593930-68593952 TGCTTGAAGCTGGGAGGAAGAGG - Intergenic
1098376148 12:69817692-69817714 TCCATGAACTTGGGAGGATGAGG + Exonic
1099802219 12:87471708-87471730 TATATAAATATGGGAGAAAGAGG - Intergenic
1100017083 12:90024151-90024173 TAGATGAGACTGGGAGAAAGAGG + Intergenic
1100192427 12:92207256-92207278 GACATGAATTTTGGAGAGAGGGG - Intergenic
1101448841 12:104757786-104757808 TACCTGAAATTGGAATAAAGGGG + Exonic
1101558975 12:105837849-105837871 TACATGAATTTGGGGGAACAGGG + Intergenic
1101576832 12:106005149-106005171 TACAGTAATATGGGAGAAAGAGG + Intergenic
1103103825 12:118205084-118205106 TGCTTGAACTTGGGAGAAGGAGG + Intronic
1103775261 12:123362591-123362613 TTTATGTAGTTGGCAGAAAGGGG - Intronic
1104252559 12:127109314-127109336 TTCCTAAAGTGGGGAGAAAGGGG + Intergenic
1104364988 12:128168608-128168630 TACATGGAGAAAGGAGAAAGGGG - Intergenic
1106507568 13:30384670-30384692 TGCATGAACCTGGGAGACAGGGG - Intergenic
1107307070 13:39033925-39033947 AACATGAATTGGGGTGAAAGTGG + Intronic
1107439260 13:40410075-40410097 TGCTTGAACTTGGGAGACAGAGG - Intergenic
1108670259 13:52680008-52680030 TACAAGAAATTGGGATAAATTGG + Exonic
1108831379 13:54483714-54483736 TGCTTGAACTTGGGAGACAGAGG - Intergenic
1108861377 13:54863617-54863639 TACATCAAGTTGGGTGAAATGGG - Intergenic
1109093668 13:58082644-58082666 GACAAGAGGTTGGGAGAAGGTGG - Intergenic
1109226895 13:59707920-59707942 GAAATGAAGTGGGGAGAAATTGG - Intronic
1109290354 13:60466702-60466724 CACTTGAACTTGGGAGACAGAGG + Intronic
1110068002 13:71133258-71133280 TACATGGATTTGGGAGGAGGAGG + Intergenic
1110306048 13:73987815-73987837 TAGATGAAGTGGGAGGAAAGAGG + Intronic
1110371756 13:74748210-74748232 CACTTGAACCTGGGAGAAAGAGG + Intergenic
1110710116 13:78641764-78641786 CTCAAGAAGTTGGGAGAAAAAGG - Intronic
1110836156 13:80085900-80085922 TGCATGAACTTGGGAGGCAGAGG - Intergenic
1111012809 13:82333256-82333278 CAGATAAATTTGGGAGAAAGGGG - Intergenic
1111205522 13:85004325-85004347 TACATGAAGTTGGAAGATGTAGG - Intergenic
1111723890 13:91980478-91980500 GACTGGAAGTTGGGAGAAAGGGG - Intronic
1111770694 13:92592190-92592212 TAGCTGAAGTTTGGAGAGAGTGG + Intronic
1111929879 13:94502319-94502341 AACATGATGGTGAGAGAAAGGGG - Intergenic
1112221381 13:97494716-97494738 TACTTGAAGTAGGGAGGAAAGGG + Intergenic
1112285471 13:98100243-98100265 TGCATGAACTTGGGAGGCAGAGG + Intergenic
1112795311 13:103050353-103050375 TGTATGAAGTTGGGAAAGAGAGG - Intronic
1112848188 13:103669899-103669921 AACCTGAAGAAGGGAGAAAGAGG - Intergenic
1112883925 13:104145326-104145348 TAAATGAAATTGGAAGAAGGTGG - Intergenic
1112998262 13:105600500-105600522 TTCATGGAGCTGGGGGAAAGAGG - Intergenic
1113067243 13:106384819-106384841 TACATTAATATGTGAGAAAGTGG - Intergenic
1113114517 13:106861085-106861107 CACATGAACCTGGGAGGAAGAGG - Intergenic
1114933847 14:27508044-27508066 TATATAAAGTTCAGAGAAAGAGG - Intergenic
1114969018 14:28002204-28002226 GACAGGGAGTTGGGGGAAAGGGG - Intergenic
1115073102 14:29350080-29350102 TGTAAGAATTTGGGAGAAAGGGG + Intergenic
1116180382 14:41524725-41524747 AACATAAATTTGGGAGAAACAGG - Intergenic
1116203896 14:41836115-41836137 TACTTGGACTTGGGGGAAAGAGG + Intronic
1116462380 14:45192557-45192579 TGCTTGAAGCTGGGAGAGAGAGG + Intronic
1116576226 14:46579823-46579845 CATATGAATTTGGGAGACAGGGG - Intergenic
1117117798 14:52534268-52534290 TAGAAGTAGTTGGGAGAAGGTGG - Intronic
1117177660 14:53161529-53161551 TACTTGAACCTGGGAGACAGAGG + Intergenic
1117245309 14:53879006-53879028 TGAATGAAGTTAGGAGAAAAAGG - Intergenic
1117429243 14:55636456-55636478 TACAAGAAGCTGAGAGAAGGTGG + Exonic
1118218123 14:63828645-63828667 TACTTGAACTTGGGAGGCAGAGG + Intergenic
1119655064 14:76411362-76411384 CACTTGAATCTGGGAGAAAGAGG + Intronic
1120455695 14:84727767-84727789 TACATGAAGGCCAGAGAAAGAGG + Intergenic
1121298547 14:92850514-92850536 TACCTGAAGTTAGGTGAAACTGG - Intergenic
1121864983 14:97354508-97354530 TACATGAAGTTGGTAGGAAGAGG + Intergenic
1122370032 14:101224608-101224630 AACATGGAGTGGGGGGAAAGAGG - Intergenic
1122594431 14:102879354-102879376 CACTTGAACCTGGGAGAAAGAGG - Intronic
1124465630 15:29936728-29936750 GACATGAATTTGGGAGCACGGGG - Intronic
1124577130 15:30919603-30919625 CACATGAACCTGGGAGACAGAGG + Intronic
1125436157 15:39647033-39647055 TACATGAAGATAGAATAAAGTGG + Intronic
1125871046 15:43102054-43102076 CACTTGAACTTGGGACAAAGAGG + Intronic
1127757409 15:62105960-62105982 TACATGCTGTTGGGAAAAAATGG - Intergenic
1129923114 15:79337457-79337479 TAGAATAATTTGGGAGAAAGGGG + Intronic
1130354711 15:83118735-83118757 AGCATGAACGTGGGAGAAAGAGG + Intronic
1130643150 15:85698379-85698401 TGCTTGAACTTGGGAGACAGAGG + Intronic
1131475289 15:92733424-92733446 TACTAGAGGATGGGAGAAAGGGG + Intronic
1133475432 16:6116823-6116845 GAGATGAAATTGGGAGACAGAGG + Intronic
1133475440 16:6116891-6116913 AAGATGAAATTGGGAGACAGAGG + Intronic
1133672284 16:8034501-8034523 TACTTGAACTTGGGAGGCAGAGG - Intergenic
1135257364 16:20951822-20951844 TGCATGAAGTGGGGAGGCAGAGG - Intronic
1136005387 16:27325488-27325510 TACTTGAACCTGGGAGACAGAGG + Intronic
1137608808 16:49805230-49805252 AACTGGAAGGTGGGAGAAAGAGG - Intronic
1138354957 16:56370280-56370302 TACATCATGTTAGGTGAAAGAGG + Intronic
1139012328 16:62648183-62648205 CACTTGAACTTGGGAGACAGAGG + Intergenic
1139909908 16:70391380-70391402 GACATGAATTTGGGAGAGGGAGG - Intronic
1140493985 16:75367078-75367100 TACTTGAACCTGGGAGACAGAGG + Intronic
1141388387 16:83644176-83644198 TTAATGAAATTGGGAGAATGTGG - Intronic
1141628244 16:85272858-85272880 TACTTGAACCTGGGAGACAGAGG - Intergenic
1141776226 16:86124196-86124218 TACTTGAAGTCGGGAGGCAGAGG + Intergenic
1142298855 16:89244618-89244640 TACTTGAACCTGGGAGACAGAGG + Intergenic
1142862701 17:2772804-2772826 TACTTGAAGTGGGGGAAAAGGGG + Intergenic
1144333098 17:14242169-14242191 TGCATGAACCTGGGAGACAGAGG - Intergenic
1146031680 17:29371682-29371704 CACTTGAACTTGGGAGATAGAGG + Intergenic
1146361005 17:32177906-32177928 TGCATGAACCTGGGAGACAGAGG - Intronic
1146385882 17:32372805-32372827 TAGATGAAGTTGAGTCAAAGTGG + Exonic
1146470987 17:33124688-33124710 TACATGGACTGGGGAGAAGGGGG + Intronic
1147716574 17:42512707-42512729 AACATGGGGATGGGAGAAAGTGG - Intronic
1148045089 17:44738561-44738583 TCCATGACAATGGGAGAAAGTGG - Intronic
1148587202 17:48789636-48789658 TGCTTGAACTTGGGAGACAGAGG - Intronic
1149027337 17:52042819-52042841 TAAATGATGTTGGGAAAAATAGG - Intronic
1149308866 17:55374694-55374716 TGCTTGAACTTGGGAGACAGAGG + Intergenic
1149314192 17:55422875-55422897 CACTTGAACTTGGGAGATAGAGG + Intergenic
1150114004 17:62528633-62528655 TACTTGAAGTCAGGAGATAGAGG - Intronic
1150766388 17:68005416-68005438 TGCTTGAACTTGGGAGACAGAGG + Intergenic
1151132069 17:71907467-71907489 TGCTTGAACTTGGGAGACAGAGG + Intergenic
1151540998 17:74764455-74764477 TCCATGAACTTGGGAGATAAGGG - Intronic
1151970184 17:77453768-77453790 AACAGGAAGTTGGGAGAATACGG - Intronic
1153232634 18:2954541-2954563 CACATGAAGTTGGGTGATAACGG - Exonic
1154157138 18:11952550-11952572 TGCTTGAACTTGGGAGACAGAGG - Intergenic
1154211988 18:12387323-12387345 CACTTGAACTTGGGAGACAGAGG + Intergenic
1154298830 18:13175057-13175079 TCCATGGAGCTGGGAGAGAGGGG + Intergenic
1154406671 18:14098242-14098264 TACCTGAACCTGGGAGGAAGAGG - Intronic
1154443241 18:14411668-14411690 TGCATGGAGCTGGGAGAATGGGG + Intergenic
1155993520 18:32305601-32305623 TACTTGAACTTGGGAGGCAGAGG - Intronic
1156712688 18:39965911-39965933 TAGAGGATATTGGGAGAAAGTGG + Intergenic
1156770650 18:40718588-40718610 TAGATAAAGTTGGGAGGAAAAGG - Intergenic
1157651584 18:49337957-49337979 TAAAAGAAGGTGGGGGAAAGGGG + Intronic
1157657592 18:49406475-49406497 TACTTGAACCTGGGAGACAGAGG + Intronic
1157667883 18:49503040-49503062 TGCTTGAAGCTGGGAGACAGAGG + Intergenic
1158014771 18:52771209-52771231 TACATGAAGCAGGCAGAAGGTGG + Intronic
1159582087 18:70244763-70244785 TCCTTGAAGTTGGGTGACAGAGG + Intergenic
1159948432 18:74460847-74460869 GATATAAAGATGGGAGAAAGTGG + Intergenic
1161871190 19:6871362-6871384 TGCTTGAAGCTGGGAGAAGGAGG + Intergenic
1162332197 19:10037270-10037292 TACTTGAACGTGGGAGACAGAGG + Intergenic
1162718833 19:12649812-12649834 TACATGAGTGTGGGAGACAGAGG - Intronic
1164007287 19:21162058-21162080 TACTTGAACCTGGGAGACAGAGG - Intronic
1164047944 19:21558884-21558906 TAGATGGAGTTGTCAGAAAGAGG - Intergenic
1164056640 19:21627692-21627714 TAAAGGAAATAGGGAGAAAGGGG - Intergenic
1164414525 19:28035453-28035475 CACATGAACTTGGGAGGCAGAGG - Intergenic
1164687092 19:30174043-30174065 TGCTTGAAGCTGGGACAAAGAGG - Intergenic
1164881443 19:31735623-31735645 TTCATGAAGTAGGGAGGAAGGGG - Intergenic
1165475741 19:36029641-36029663 GAAATGAAGGAGGGAGAAAGAGG - Intronic
1166229738 19:41419523-41419545 TGCTTGAAGCTGGGAGAAGGAGG - Intronic
1167611339 19:50509159-50509181 TGCTTGAAGCTGGGAGACAGAGG - Intronic
1167615287 19:50529716-50529738 TGCATGAACTTGGGAGGAGGAGG + Intronic
1167940041 19:52939423-52939445 CACATGAACTTGGGAGGTAGAGG - Intronic
1167988267 19:53336424-53336446 CACATGAACTTGGGAGGTAGAGG + Intronic
1168220714 19:54958267-54958289 TAGGAGAAGTAGGGAGAAAGAGG + Intronic
1168397218 19:56058580-56058602 TACAGGAATATGGGAGATAGAGG + Intronic
925658175 2:6172275-6172297 CACTTGAACTTGGGAGACAGAGG + Intergenic
926252997 2:11166453-11166475 GACAAGATGTTGGGGGAAAGGGG - Intronic
926773257 2:16397068-16397090 CAGATGAAGATGGGAGAAAGAGG + Intergenic
929171720 2:38938851-38938873 AACATTATGTTGGGAGAAAGAGG - Intronic
929179800 2:39025431-39025453 TACTTGAAGCTGGGAGGCAGAGG - Intronic
929181719 2:39047752-39047774 TGCTTGAACTTGGGAGATAGAGG - Intronic
929499160 2:42475410-42475432 CACTTGAACCTGGGAGAAAGAGG - Intronic
929537851 2:42794837-42794859 TACATGAAAGGGTGAGAAAGTGG - Intergenic
931673530 2:64671324-64671346 TTCAGGATGGTGGGAGAAAGTGG + Intronic
933378268 2:81508810-81508832 CACTTGAACCTGGGAGAAAGAGG + Intergenic
935201985 2:100865269-100865291 TCCATGAAGTTGGGAGTCCGTGG + Intronic
935584295 2:104786559-104786581 TTCATAAAGTTGATAGAAAGAGG + Intergenic
935791198 2:106591683-106591705 TGCTTGAAGCTGGGAGACAGAGG + Intergenic
935971197 2:108532817-108532839 TACTTGAACCTGGGAGACAGAGG - Intergenic
936538477 2:113330716-113330738 GAAAGGAAGTTGGGTGAAAGGGG - Intergenic
936837180 2:116722798-116722820 CACATGAAGCTGTGAGAAGGGGG - Intergenic
938061166 2:128255362-128255384 TGCTTGAAGCTGGGAGACAGGGG + Intronic
938568289 2:132540103-132540125 TACAGGAAGTTTGGGGAATGGGG - Intronic
939303567 2:140379609-140379631 TACTTGAATCTGGGAGACAGAGG + Intronic
939413206 2:141858218-141858240 TACATGAATATGGGAGTAAATGG - Intronic
939855909 2:147358310-147358332 TCCATTAAGTTGAGAGAAGGAGG + Intergenic
940853556 2:158711062-158711084 TACTTGAACCTGGGAGGAAGAGG - Intergenic
940883858 2:158971579-158971601 TTCATAACGTGGGGAGAAAGGGG - Intronic
940943203 2:159587015-159587037 TACATTAAGTTGTTAAAAAGGGG - Intronic
942201956 2:173580166-173580188 TACCAGAAGTTCAGAGAAAGGGG + Intergenic
942351803 2:175060343-175060365 TACATTAATTTGGGAAAAACTGG + Intergenic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
942789925 2:179749371-179749393 TACATGGAGTTTGGAGGAGGTGG - Intronic
944231007 2:197392755-197392777 TACAGGCAGTGGGGGGAAAGGGG + Intronic
944280337 2:197888374-197888396 TACATTAAATTAGGTGAAAGTGG + Intronic
944650908 2:201829362-201829384 GAGATGATGGTGGGAGAAAGTGG + Intronic
945177878 2:207061911-207061933 TGCTTGAACTTGGGAGACAGAGG + Intergenic
945853828 2:215042851-215042873 TACCAGAGGTTGGGTGAAAGGGG - Intronic
945941691 2:215957449-215957471 GAGATGAAGTGGGGACAAAGTGG - Intronic
946263061 2:218512422-218512444 TGCTTGAACTTGGGAGACAGAGG + Intronic
946885275 2:224216739-224216761 CACTTGAACTTGGGAGACAGAGG - Intergenic
947176490 2:227372555-227372577 TACTTGAACCTGGGAGACAGAGG + Intronic
947348838 2:229221632-229221654 TAGATGAAATTGGGAGAGTGTGG - Intronic
949014221 2:241700708-241700730 TACTTGAACTTGGGAGAGGGAGG - Intergenic
949077515 2:242070502-242070524 TACATGAAGTAAGGAGAGAAAGG - Intergenic
1168863179 20:1060797-1060819 TACATGAAGTTGTGGGAAGATGG - Intergenic
1169255584 20:4094520-4094542 CACTTGAACTTGGGAGACAGAGG + Intergenic
1170205291 20:13791523-13791545 TACTTAGGGTTGGGAGAAAGAGG + Intronic
1170519085 20:17165100-17165122 TGCATGAACTTTGGAGAAAATGG + Intergenic
1170793185 20:19524644-19524666 TACATGAAGTGGGGAACAGGTGG - Intronic
1170841402 20:19927496-19927518 TACTTGAACCTGGGAGACAGAGG - Intronic
1172265162 20:33605758-33605780 TACATCAAGTAGGAAAAAAGAGG - Intronic
1172460763 20:35116655-35116677 CACAAAAAGTTGGGATAAAGGGG - Intronic
1172827324 20:37800633-37800655 TACATGTATTTGGGAGAGTGTGG - Intronic
1173082325 20:39880063-39880085 CAGATGAAGATGGGGGAAAGAGG + Intergenic
1174074542 20:47923780-47923802 TACATGGAGTTGGGGGTAAGGGG + Intergenic
1174161338 20:48552885-48552907 TACCAGAAGTTGGGAAAGAGGGG - Intergenic
1175037670 20:56015781-56015803 AACTTGAACTTGGGAGACAGAGG - Intergenic
1175157845 20:56984485-56984507 TACTGGAAGCTGGAAGAAAGGGG + Intergenic
1175325812 20:58127845-58127867 CACATCAAGCTGGGAGGAAGAGG - Intergenic
1175361625 20:58415433-58415455 AACATGAATTTGGGAGAAACTGG - Intronic
1177317296 21:19478234-19478256 CACTTGAATTTGGGAGACAGAGG + Intergenic
1177633243 21:23753485-23753507 CACTTGAAGCTGGGAGACAGAGG - Intergenic
1177673398 21:24264610-24264632 TACTTCAATTTGGGAGACAGAGG - Intergenic
1177974868 21:27835840-27835862 TATGTAAAGTTGGGAGGAAGAGG - Intergenic
1179371806 21:40812827-40812849 TAAAAGAAGGAGGGAGAAAGTGG + Intronic
1179554073 21:42161336-42161358 TGCTTGAACCTGGGAGAAAGAGG + Intergenic
1179580637 21:42341528-42341550 TACTTGAACCCGGGAGAAAGAGG - Intergenic
1180101217 21:45587686-45587708 AGAATGAAGTTGGGAGCAAGAGG - Intergenic
1180288372 22:10774193-10774215 TTTTTGAAGATGGGAGAAAGAGG - Intergenic
1182277130 22:29196803-29196825 TGCTTGAACTTGGGAGACAGAGG + Intergenic
1182315173 22:29441223-29441245 TGCATCAAGGTGGTAGAAAGGGG + Intronic
1182372057 22:29818164-29818186 TGAAAGAAGGTGGGAGAAAGGGG - Intronic
1182694910 22:32191650-32191672 TGCATCAAGGTGGTAGAAAGGGG - Intronic
1182716480 22:32359933-32359955 CACATCAAGGTGGTAGAAAGGGG + Exonic
1184081106 22:42220848-42220870 TTCCTGGAGTTTGGAGAAAGTGG - Intronic
950350323 3:12343942-12343964 TACTTGAACTTGGGAGGCAGAGG - Intronic
950400094 3:12763243-12763265 TACCTGAACTTGGGAGTAGGAGG - Intronic
950838933 3:15948062-15948084 TGCTTGAACTTGGGAGACAGAGG + Intergenic
951229940 3:20166562-20166584 TACCAGAGGTTGGGAGAGAGGGG + Intronic
951312922 3:21151590-21151612 GACATGGAGGTGGGAGGAAGTGG - Intergenic
952970109 3:38645367-38645389 TACATGAAGAAGGCAGAGAGAGG - Intronic
953078501 3:39593651-39593673 GACATGAAAGTGGGAGAGAGGGG - Intergenic
954584961 3:51725518-51725540 TACATGATGTTGGGAAAATTGGG - Intergenic
955293533 3:57714646-57714668 TGCTTGAACTTGGGAGACAGAGG + Intergenic
955869569 3:63423153-63423175 TTCATGACTTTGGGAGAAAAGGG + Intronic
956636941 3:71374507-71374529 TGCTTGAACCTGGGAGAAAGAGG + Intronic
956678553 3:71757077-71757099 TTCATGATGTGGGGAGAAATAGG - Intergenic
957682678 3:83457918-83457940 TAGAGGAAGTTGAGAAAAAGTGG - Intergenic
957719470 3:83974941-83974963 TAGCTGAAGTTGTAAGAAAGAGG - Intergenic
957982429 3:87526559-87526581 TGCATGAACCTGGGAGACAGAGG - Intergenic
958137894 3:89519989-89520011 GTCATGAAGTTTGGAGATAGAGG + Intergenic
958475630 3:94577381-94577403 TAGATCAAGTGGGGAGAAACCGG - Intergenic
958806157 3:98813338-98813360 TGCTTGAACTTGGGAGGAAGAGG - Intronic
960020369 3:112945137-112945159 TAGATCAAGTTGGGAAAAACTGG - Intronic
960202569 3:114855539-114855561 TCCTGGAACTTGGGAGAAAGGGG + Intronic
960203936 3:114871945-114871967 TACATAAAGTTGGGAGGAACTGG - Intronic
960689353 3:120327827-120327849 CACTTGAACTTGGGAGACAGAGG - Exonic
960920465 3:122741845-122741867 TCCATGAAATTGGCAAAAAGGGG + Intronic
961911512 3:130321841-130321863 TAAATGATGTTGGGAAAAACTGG + Intergenic
963017432 3:140839413-140839435 TAATCAAAGTTGGGAGAAAGAGG + Intergenic
963146849 3:142002966-142002988 TACATGAAGTGGGGCAGAAGGGG + Intronic
963356394 3:144213423-144213445 TACCTGAGGCTGGGAAAAAGAGG + Intergenic
963543728 3:146627935-146627957 TATATGAATTTGGAAGACAGAGG + Intergenic
963724492 3:148904780-148904802 TAGATGATTTTGGGAGAAAGTGG - Intergenic
963773397 3:149413652-149413674 TGCTTGAACTTGGGAGACAGAGG - Intergenic
964662736 3:159138618-159138640 TACATAAAGTGAGGAGAAATTGG + Intronic
964949412 3:162269752-162269774 TAAATGAAGGTAGGAGGAAGAGG + Intergenic
964976426 3:162625878-162625900 TACATGAAAGTGAGAGAAAGAGG - Intergenic
965041888 3:163519400-163519422 TGCTTGAACTGGGGAGAAAGAGG - Intergenic
965875645 3:173315635-173315657 TATTTGAAGTTGAGAAAAAGTGG - Intergenic
965902300 3:173657275-173657297 CACATGGAGTTGGAAGAATGGGG - Intronic
965925081 3:173968780-173968802 TACATGAACCTGGGAGGCAGAGG - Intronic
965993791 3:174853292-174853314 TGCTTGAACTTGGGAGGAAGAGG + Intronic
966322529 3:178716809-178716831 TGCAGGAAGTTGGGAGGAACGGG + Intronic
966419691 3:179725126-179725148 TGCTTGAAGTTGGGAGGCAGAGG + Intronic
966747165 3:183288337-183288359 TGGATGAGGTTTGGAGAAAGGGG - Intronic
968118668 3:196109097-196109119 TGCTTGAAGCTGGGAGACAGAGG - Intergenic
969059463 4:4423676-4423698 TACGTGAAGGTGGGAGAGACAGG + Intronic
969078122 4:4596749-4596771 AACATGCAGTTGGGAGCAGGAGG - Intergenic
969370086 4:6726510-6726532 TACATGAACCTGGGAGGCAGAGG - Intergenic
970434229 4:16017889-16017911 TACATGAAGTTCTGAGATATAGG - Intronic
970604453 4:17666385-17666407 TGCTTGAACTTGGGAGACAGAGG - Intronic
970831538 4:20345867-20345889 TCCATGAAGATAGGAGAAAGGGG - Intronic
970875066 4:20859670-20859692 TAAGAGAAGTTGTGAGAAAGAGG - Intronic
971225871 4:24751108-24751130 TACAAGAAGTTTAGAGGAAGGGG - Intergenic
971289931 4:25328321-25328343 TGCTTGAACTTGGGAGACAGAGG - Intronic
971728666 4:30347834-30347856 TTCAGGAAGAAGGGAGAAAGTGG + Intergenic
972170725 4:36342419-36342441 AGCATGAAAGTGGGAGAAAGTGG + Intronic
972362318 4:38338589-38338611 TGCTTGAAGCTGGGAGACAGAGG - Intergenic
972621871 4:40755171-40755193 CACTTGAACCTGGGAGAAAGAGG - Intronic
973009573 4:45054536-45054558 TAAAGGAAGTTGTGAGAATGAGG + Intergenic
973974683 4:56250863-56250885 TAAATGAAGTTGGTTGCAAGGGG - Intronic
974026836 4:56740330-56740352 TACATGAAGTTTGGATTGAGTGG + Intergenic
974211507 4:58782908-58782930 TATATTATGTTGGGGGAAAGAGG - Intergenic
974313833 4:60250708-60250730 TACATGAAGTTCTGAGGAAGAGG + Intergenic
975762062 4:77630438-77630460 TACATGAAGTGAGGACAAAATGG + Intergenic
976338834 4:83922161-83922183 TACTTGGAGTTGGGAGAAAAAGG + Intergenic
977170544 4:93756621-93756643 TAGATGAAGTCAGGAGAATGGGG - Intronic
977253354 4:94713085-94713107 GACATGAACTGGGGGGAAAGAGG - Intergenic
977315894 4:95447582-95447604 TGCTTGAACCTGGGAGAAAGAGG - Intronic
978457645 4:108911963-108911985 TAAATAAAGTCGGGAGAAAGTGG + Intronic
978557895 4:110000165-110000187 TACTTGAACTTGGGAGGCAGGGG + Intronic
979012737 4:115392089-115392111 TAAATGATGTTGGGAAAAACTGG + Intergenic
979997873 4:127454274-127454296 TACTTGAACTTGGGAGGCAGAGG + Intergenic
980089349 4:128425944-128425966 TACATGGAGCTGGATGAAAGAGG + Intergenic
980133654 4:128840346-128840368 AACATGAAGTAGGGAGAAGAGGG - Intronic
980333873 4:131443466-131443488 TGCTTGAACTTGGGAGAAGGAGG + Intergenic
980830980 4:138128947-138128969 TGCTTGAACTTGGGAGACAGAGG - Intergenic
982057309 4:151564980-151565002 AACAGTAAGATGGGAGAAAGTGG - Intronic
982556527 4:156873319-156873341 TTCAGGAATTTGGGAGTAAGGGG - Intronic
983168849 4:164512968-164512990 CACAAGAAGGAGGGAGAAAGAGG + Intergenic
983770595 4:171544488-171544510 TACATAAAATTGGGGGAAATTGG + Intergenic
983834053 4:172368295-172368317 TGCATGAACTTGGGAGGCAGAGG + Intronic
983928140 4:173424823-173424845 TACTTGAACCTGGGAGACAGAGG + Intergenic
984802641 4:183729023-183729045 TACTTGAATTTGGGAGGCAGAGG - Intergenic
985081300 4:186267039-186267061 TACAAGAAATAGGGAGAGAGGGG - Intronic
985270243 4:188187506-188187528 TGCTTGAACCTGGGAGAAAGGGG - Intergenic
985823284 5:2175598-2175620 TACATTAATTTGGAAGAAAAGGG + Intergenic
987109123 5:14668245-14668267 TTCATGAGGTTGGGAGAAAGTGG - Intronic
987112536 5:14701146-14701168 GACAAGAAGTGGGGAGACAGAGG - Intergenic
987230136 5:15885383-15885405 TAAATGAAATTTGGAAAAAGTGG - Intronic
987917807 5:24238637-24238659 AACAAGAAAGTGGGAGAAAGGGG - Intergenic
988341801 5:29981944-29981966 TACCTGAAGTAGGAACAAAGAGG - Intergenic
988925349 5:35984554-35984576 TACTTGAACTTGGGAGGCAGAGG - Intronic
989014633 5:36916201-36916223 TACATGAACTTGTAATAAAGAGG - Intronic
990064125 5:51691221-51691243 TACCTGGAGTAGGTAGAAAGGGG + Intergenic
990379585 5:55209095-55209117 CACTTGAACCTGGGAGAAAGAGG + Intergenic
991238836 5:64432340-64432362 CACTTGAATTTGGGAGGAAGAGG + Intergenic
991544673 5:67768241-67768263 GAGATGAAGGTGGGAGATAGGGG - Intergenic
991563930 5:67984923-67984945 TACATGAAGCTGGGGCACAGTGG - Intergenic
991622875 5:68564240-68564262 TAGATTAATTTGGGAAAAAGTGG - Intergenic
992316165 5:75557405-75557427 TAGATGAAGTTGGGAAGAACTGG + Intronic
992379842 5:76226313-76226335 TAAATGAAGCTGGCAGAAAAGGG + Intronic
992496776 5:77301421-77301443 TACATGAAGTTGGGAGAAAGTGG - Intronic
992794418 5:80242837-80242859 TGCTTGAACTTGGGAGACAGTGG + Intronic
993785876 5:92134904-92134926 TACAAGAAGTTGGGAGTTGGGGG - Intergenic
994017339 5:94982803-94982825 TGCATGAACCTGGGAGGAAGAGG + Intronic
994368513 5:98943741-98943763 CACACAAAGCTGGGAGAAAGGGG + Intergenic
994500734 5:100574270-100574292 CACTTGAACCTGGGAGAAAGAGG - Intronic
994504811 5:100629133-100629155 CACTTGAACATGGGAGAAAGAGG - Intergenic
995514313 5:112939054-112939076 TGCATGAACCTGGGAGACAGAGG - Intergenic
995813950 5:116145124-116145146 GTCATGAGGTTGGGAGAATGGGG + Intronic
996175355 5:120349693-120349715 AGCAAGAAGTTGGGAGCAAGTGG - Intergenic
996314452 5:122146121-122146143 TGCAAGAAGTGGGGAGCAAGAGG - Intronic
996647381 5:125832883-125832905 TACATAAAGTTCAGAGAAAAAGG - Intergenic
997387822 5:133487578-133487600 TACATCAACTTGGGAGACACTGG - Intronic
997886831 5:137637737-137637759 TAGAGGAAGCTGGGGGAAAGGGG - Intronic
998038261 5:138934750-138934772 CATTTGAAGCTGGGAGAAAGAGG - Exonic
1000927156 5:167207835-167207857 CACTTGAACTTGGGAGACAGAGG - Intergenic
1001209197 5:169794344-169794366 AACATGAAGTTTGGATGAAGAGG - Intronic
1001224533 5:169932396-169932418 GACATGAAGTAGGGAGAGAATGG + Intronic
1001857809 5:175027878-175027900 TGTAGGAAGTTGGGAGAATGGGG + Intergenic
1002206753 5:177568303-177568325 TGCATGAACCTGGGAGACAGAGG + Intergenic
1003212969 6:4083633-4083655 TACTTGAACCTGGGAGACAGAGG - Intronic
1004111556 6:12723609-12723631 TACAGGTACTTGGGAGAATGAGG - Intronic
1004258976 6:14090881-14090903 TACATGAATTTGGTGGCAAGGGG + Intergenic
1005388431 6:25309269-25309291 TACTTGAAGTTGGGAGGTGGAGG + Intronic
1005528492 6:26677008-26677030 TACTTGAACCTGGGAGACAGAGG + Intergenic
1005542303 6:26824631-26824653 TACTTGAACCTGGGAGACAGAGG - Intergenic
1006255153 6:32826871-32826893 TCCATGTAGTTGGGAGATACAGG + Intronic
1006626605 6:35402407-35402429 CACCTGCAGTAGGGAGAAAGGGG - Intronic
1007022769 6:38538865-38538887 CACATGAGCTTGGGAGACAGAGG - Intronic
1008162333 6:48093693-48093715 TATATGAAGGTGGGGAAAAGGGG - Intergenic
1009416946 6:63426399-63426421 TATATGAAGTTGGTAGAGGGCGG - Intergenic
1010547580 6:77176658-77176680 TGCATTAAGTTGGCAGAAAATGG + Intergenic
1011287185 6:85737369-85737391 TTCATGGAGGTAGGAGAAAGAGG + Intergenic
1011451591 6:87498155-87498177 TAAATGAATATGGGAGAAGGTGG + Intronic
1011665799 6:89631977-89631999 TCCATGAAGTTGGGGAACAGTGG - Intronic
1012461519 6:99467288-99467310 AACCTGAGGTTGGGAGAAAATGG + Intronic
1012670451 6:102039050-102039072 TATATGAATTTGGGGGAAAATGG - Intronic
1013105447 6:107023282-107023304 TGCTTGAACTTGGGAGACAGAGG - Intergenic
1013284570 6:108670071-108670093 TATATGGAGATGGGAGAAGGGGG + Intronic
1013298861 6:108784093-108784115 TATATGAAGGGGGGAGAGAGAGG - Intergenic
1013592770 6:111633394-111633416 CACTTGAAGTCGGGAGACAGAGG - Intergenic
1014028536 6:116675936-116675958 AATTTGAATTTGGGAGAAAGTGG + Intergenic
1014273319 6:119358438-119358460 TGCTTGAACTTGGGAGACAGAGG + Intergenic
1015073187 6:129122729-129122751 TGCATGAGGTTGGGAGTTAGCGG - Intronic
1015356045 6:132278058-132278080 TACTTGAACCTGGGAGACAGCGG - Intergenic
1015615775 6:135073121-135073143 GACAAGAAGTTGGGAAAAATGGG + Intronic
1015753576 6:136585581-136585603 CACTTGAAGTTGGGAGGCAGAGG - Intronic
1015966556 6:138699851-138699873 GACATGAAGTATGGAGGAAGAGG + Intergenic
1015996422 6:138999437-138999459 GACATCACGTGGGGAGAAAGTGG - Intergenic
1016242440 6:141946399-141946421 TAAATAAAGATGGGAGAAATGGG + Intergenic
1016488856 6:144573610-144573632 TACTTGAACTTGGGAGGTAGAGG + Intronic
1016556840 6:145348029-145348051 TGCATGAATTTGGAAGAAGGAGG + Intergenic
1016806157 6:148214337-148214359 TACATGCAGTTGAGTGAAAATGG + Intergenic
1017926264 6:158913983-158914005 TCCTTGAAGTGTGGAGAAAGAGG + Intergenic
1018029961 6:159834063-159834085 GGCATGAAGTTGGGGGAGAGCGG + Intergenic
1018751706 6:166812270-166812292 TGCTTGAACTTGGGAGACAGAGG + Intronic
1019850634 7:3553363-3553385 TGTATTTAGTTGGGAGAAAGTGG - Intronic
1020739459 7:11995445-11995467 AACATTAAAATGGGAGAAAGAGG + Intergenic
1020995645 7:15260291-15260313 TACATAAACTTAAGAGAAAGGGG + Intronic
1021591494 7:22268559-22268581 TATTTGGAGTTGGGACAAAGAGG + Intronic
1022733298 7:33052400-33052422 CACTTGAAGCTGGGAGACAGAGG + Intronic
1023569886 7:41560945-41560967 TACTTGAACTTGGGAGGCAGAGG + Intergenic
1023673953 7:42610770-42610792 TACATTTGGTTGGGAGATAGGGG + Intergenic
1023831697 7:44042221-44042243 TACTTGAACTTGGGAGGCAGAGG + Intergenic
1024489376 7:49960335-49960357 TGCTTGAACCTGGGAGAAAGAGG + Intronic
1025930641 7:65990850-65990872 TGCTTGAACCTGGGAGAAAGAGG + Intergenic
1026597757 7:71748629-71748651 TGCTTGAACTTGGGAGACAGAGG + Intergenic
1027525639 7:79266061-79266083 TGCATGAAGTAGTGAGAGAGGGG - Intronic
1028457052 7:91049917-91049939 TTCAGGAAGTTCTGAGAAAGGGG + Intronic
1028972801 7:96877254-96877276 TAGATAAAGGAGGGAGAAAGAGG - Intergenic
1028990888 7:97047633-97047655 TTAATGAAGGTGGGACAAAGAGG + Intergenic
1029553714 7:101252911-101252933 TGCTTGAAGTCGGGAGAAGGAGG + Intergenic
1029848200 7:103435415-103435437 TACATGACAGTGGAAGAAAGTGG - Intronic
1030075382 7:105732327-105732349 TGCTTGAACCTGGGAGAAAGAGG + Intronic
1030562289 7:111104282-111104304 TACAGGAAATTGGGACACAGAGG - Intronic
1031486495 7:122332838-122332860 TTCATGTAGTTTGAAGAAAGAGG - Intronic
1031656335 7:124360656-124360678 TACTTGAACCTGGGAGACAGAGG + Intergenic
1032328831 7:130958385-130958407 TGCATGAACCTGGGAGACAGAGG - Intergenic
1032749583 7:134825162-134825184 TAGATAAAGTGGGGAGAAAGGGG + Intronic
1034611919 7:152378966-152378988 TTTTTGAAGATGGGAGAAAGAGG - Intronic
1035178101 7:157067917-157067939 CACTTGAACTTGGGAGACAGAGG - Intergenic
1035716283 8:1757522-1757544 TACATGAACCTGGGAGGCAGAGG - Intronic
1036556777 8:9867094-9867116 TACAGGAGGCTGGGAGACAGAGG - Intergenic
1036919703 8:12840311-12840333 TACTTGAATTTGGGAGGCAGAGG - Intergenic
1036937181 8:13014548-13014570 TAGATGAAGTTGTGAGAGTGGGG - Intronic
1038128349 8:24699809-24699831 TGCTTGAACTCGGGAGAAAGAGG - Intergenic
1038407351 8:27331905-27331927 TACATGGAGCTGGGTGAGAGGGG - Intronic
1038931961 8:32203455-32203477 TGCTTGAAGCTGGGAGACAGAGG - Intronic
1039681207 8:39738300-39738322 TACTTGAACCTGGGAGACAGAGG + Intergenic
1039799033 8:40938503-40938525 TACTTGAAGCTGGGAGGCAGAGG + Intergenic
1039984453 8:42436030-42436052 CACTTGAACTTGGGAGAAGGAGG + Intronic
1041072615 8:54140087-54140109 TTCATGAAGCTGAAAGAAAGTGG - Intronic
1043574519 8:81642640-81642662 CACTTGAACTTGGGAGACAGAGG + Intergenic
1043795043 8:84526033-84526055 TGCTTGAAGTTGGGAGTCAGAGG - Intronic
1044147794 8:88739443-88739465 TACTTGAACCTGGGAGACAGAGG - Intergenic
1045533474 8:103005574-103005596 TACTTGAAGTCGGGGGGAAGTGG + Intergenic
1046141536 8:110100145-110100167 ACCATGATGTTGGGAGAAATCGG + Intergenic
1047217828 8:122892766-122892788 CACATGAACCTGGGAGACAGAGG - Intronic
1047698931 8:127431259-127431281 TCCATGAAATTGAGAGACAGTGG + Intergenic
1047850321 8:128850350-128850372 CAAATGAAATTGGGAGAGAGGGG + Intergenic
1047959209 8:129998713-129998735 TACTTGAAGCTGGGAGGCAGAGG - Intronic
1048236653 8:132697532-132697554 CACTTGAACTTGGGAGGAAGAGG + Intronic
1048371551 8:133782850-133782872 CACTTGAACTTGGGAGGAAGAGG - Intergenic
1048641348 8:136366128-136366150 GCCAGGAAGTTGGGAGAGAGAGG + Intergenic
1049048366 8:140171038-140171060 GACATCAAGTTGCGAGAAACAGG + Intronic
1049954514 9:679994-680016 TAGATGAAGATGAGATAAAGAGG + Intronic
1050019984 9:1272805-1272827 GTCATGAAGTTGGAAGAAAATGG - Intergenic
1050025933 9:1334639-1334661 TATATGAAGTTGGGACACACTGG + Intergenic
1050467631 9:5946644-5946666 TACACCAAGTTCGGTGAAAGAGG - Intronic
1051122456 9:13766097-13766119 TACATGAATTTGGGGGAACACGG + Intergenic
1051369309 9:16344656-16344678 TACTTGAGGTTGGGAGAGAATGG + Intergenic
1052425817 9:28303124-28303146 TACCTGATATTGGGATAAAGTGG - Intronic
1053160341 9:35809641-35809663 TACAGAAAGTAGGGAGGAAGGGG - Exonic
1053320279 9:37092059-37092081 TACATGTTTTTGGGAGAAAAAGG - Intergenic
1054828880 9:69601401-69601423 TACATGAACTTGTGCTAAAGAGG + Intronic
1054917099 9:70504996-70505018 TACTTGAAAGAGGGAGAAAGAGG - Intergenic
1055930875 9:81558825-81558847 CACATGAAGTTGGGACAGGGAGG - Intergenic
1056154976 9:83825067-83825089 TGAATGAAGCTGGGGGAAAGGGG + Intronic
1056294954 9:85183575-85183597 TGCTTGAACTTGGGAGGAAGAGG - Intergenic
1056355790 9:85800053-85800075 TGAATGAAGCTGGGGGAAAGGGG + Intergenic
1057940178 9:99274959-99274981 TGCATGGAGTTGGTTGAAAGGGG + Intergenic
1058006864 9:99925487-99925509 TACTTCAAGTTGATAGAAAGGGG - Intronic
1058009078 9:99955617-99955639 TTCATAAAGTATGGAGAAAGAGG + Intronic
1058433733 9:104942464-104942486 CACTTGAACTTGGGAGACAGAGG - Intergenic
1059582885 9:115570755-115570777 TACTTGAACCTGGGAGATAGAGG + Intergenic
1060501450 9:124159699-124159721 CACTTGAACTTGGGAGACAGAGG + Intergenic
1061085113 9:128393794-128393816 TCCATGCAGCTGGGAGACAGGGG - Intergenic
1061194747 9:129101730-129101752 TTCATGAAGGTGGGAGCCAGGGG - Intronic
1187033021 X:15507655-15507677 TACATGATTTTGGGATAAAAAGG + Intronic
1187834659 X:23419409-23419431 TACCTGAACTCGGGAGGAAGAGG + Intergenic
1187960022 X:24559537-24559559 CTTATGAAGATGGGAGAAAGTGG - Intronic
1189197086 X:39161979-39162001 AAAATGAAGTTGGCAGAAAGGGG - Intergenic
1189344507 X:40230584-40230606 AACACGAATTTGGGAGAAAATGG - Intergenic
1189370703 X:40426854-40426876 TACTTGAACTTGGGAGGCAGAGG + Intergenic
1189892963 X:45624647-45624669 TACAAGAAGTGAGGGGAAAGTGG + Intergenic
1190576605 X:51845857-51845879 CACCTGAACTTGGGAGATAGAGG - Intronic
1190757124 X:53410715-53410737 TGCTTGAACTTGGGAGACAGAGG + Intronic
1191613619 X:63143708-63143730 AACAAGACGTAGGGAGAAAGGGG + Intergenic
1191622678 X:63235219-63235241 AACAAGACGTAGGGAGAAAGGGG - Intergenic
1191729388 X:64317026-64317048 CACTTGAACTTGGGAGACAGAGG + Intronic
1192356273 X:70407189-70407211 TACTTGAACTTGGGAGGCAGAGG - Intronic
1192950625 X:76012377-76012399 AAAAAGAAGTTGGGAGAAACAGG + Intergenic
1193618697 X:83723652-83723674 TATATGAAGAAGGGAGAAAGGGG - Intergenic
1193942850 X:87697557-87697579 TACAAAAAGTTGAGAGAAACTGG + Intergenic
1194711552 X:97242445-97242467 CACTTGAACTTGGGAGACAGAGG - Intronic
1194742919 X:97596631-97596653 TACATTAATTTGGGTGATAGTGG - Intronic
1196262705 X:113603417-113603439 TGCCAGGAGTTGGGAGAAAGGGG + Intergenic
1196540563 X:116901926-116901948 TACATGAAGGGGTCAGAAAGAGG + Intergenic
1196821966 X:119708803-119708825 TACATGACATTGGGAAACAGTGG + Intergenic
1197247219 X:124178559-124178581 CACTTGAAATTGGGAGACAGAGG - Intronic
1197759671 X:130019139-130019161 TGCATGAAGTTGGGAGGATGGGG - Intronic
1197952931 X:131917525-131917547 AACACGGAGCTGGGAGAAAGGGG - Intergenic
1198156594 X:133966893-133966915 TACATGAGGGTAGGAGAAGGAGG - Intronic
1198325221 X:135564646-135564668 TACTTGAACTTGGGAGACAAAGG + Intronic
1198460397 X:136857652-136857674 CACTTGAACCTGGGAGAAAGAGG + Intronic
1199228395 X:145406968-145406990 TGCATGAACTTGGGAGGCAGAGG + Intergenic
1199531092 X:148848529-148848551 TATATGAAATTGCTAGAAAGTGG - Intronic
1200306896 X:155035247-155035269 TAAATTAAGTTGGGACAAATGGG - Intronic
1201189165 Y:11431803-11431825 TGCTTGAATTTGGGAGATAGAGG - Intergenic
1202075508 Y:21034371-21034393 TACTTGAACCTGGGAGACAGAGG - Intergenic