ID: 992497549

View in Genome Browser
Species Human (GRCh38)
Location 5:77308669-77308691
Sequence AACTCCATGCTGTGACACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992497548_992497549 26 Left 992497548 5:77308620-77308642 CCTTTAGGAAGAAAAATGATATA 0: 1
1: 0
2: 3
3: 64
4: 531
Right 992497549 5:77308669-77308691 AACTCCATGCTGTGACACAGTGG 0: 1
1: 0
2: 1
3: 12
4: 193
992497547_992497549 30 Left 992497547 5:77308616-77308638 CCTGCCTTTAGGAAGAAAAATGA 0: 1
1: 0
2: 5
3: 54
4: 425
Right 992497549 5:77308669-77308691 AACTCCATGCTGTGACACAGTGG 0: 1
1: 0
2: 1
3: 12
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992497549 Original CRISPR AACTCCATGCTGTGACACAG TGG Intronic
905503214 1:38455759-38455781 ATCTCCCTGCTGTGGCAGAGAGG + Intergenic
907312229 1:53545255-53545277 AACCCCATGCAGAGACACTGTGG + Intronic
908744696 1:67364355-67364377 CACTCCAGCCTGTGAGACAGAGG + Intronic
909429739 1:75573308-75573330 AACTCCAGACTGTGTGACAGAGG + Intronic
910310447 1:85817885-85817907 AAACCCATGCTGGAACACAGAGG - Intronic
910361853 1:86420702-86420724 ATCTCCATGCTTTGACATGGTGG + Intergenic
910761885 1:90741094-90741116 AACTGCTTGCAGTGACACAGTGG - Intergenic
912088114 1:106035549-106035571 AAGTCTATGCTGGGACACTGTGG + Intergenic
912594850 1:110864425-110864447 ATCTGCATGCTGTGACTCTGGGG - Intergenic
912627668 1:111219668-111219690 AACTCCATTCTTTGTCTCAGTGG + Intronic
913584051 1:120255867-120255889 AACTCTACCCTGTAACACAGAGG - Intergenic
913624130 1:120642474-120642496 AACTCTACCCTGTAACACAGAGG + Intergenic
917414157 1:174790861-174790883 AAGTCCATGTTGTGAAACAAAGG - Intronic
917584664 1:176414265-176414287 AACTCCAGCCTGGGAGACAGAGG - Intergenic
918257000 1:182757816-182757838 TTCTCCATGCCATGACACAGTGG - Intergenic
919114239 1:193260606-193260628 AACTCCATCCTGTTACTGAGGGG - Intergenic
919688200 1:200504091-200504113 CACTCCAGCCTGGGACACAGAGG + Intergenic
921701169 1:218270775-218270797 CACTCCAGGCTGGGAAACAGAGG - Intergenic
922442726 1:225669942-225669964 AACTCCAGCCTGGGAGACAGAGG - Intergenic
1063911511 10:10835184-10835206 CACTCCATCCTGTAAGACAGAGG - Intergenic
1064326218 10:14353929-14353951 AACCCAATGCTTTGTCACAGTGG - Intronic
1066573643 10:36801830-36801852 AATGCCAGGCTGTGACTCAGAGG - Intergenic
1066748835 10:38631979-38632001 AATTCAATGCTGTTACACAACGG + Intergenic
1066967828 10:42285807-42285829 AATTCAATGCTGTTACACAACGG - Intergenic
1069013013 10:63395442-63395464 AACTCCAGCCTGTGCAACAGAGG + Intronic
1069611904 10:69778941-69778963 AACTCTATCCTGTGGGACAGAGG - Intergenic
1070707772 10:78653805-78653827 ATAGCCATGATGTGACACAGGGG + Intergenic
1072117820 10:92380885-92380907 CACTCCAGCCTGGGACACAGAGG - Intergenic
1073852520 10:107637370-107637392 AACTCCATGTTCTGATAGAGTGG + Intergenic
1076852093 10:133098277-133098299 CACCCCATGCTGGGACCCAGGGG + Intronic
1078797779 11:14610379-14610401 ATCTCAATCCTGTGCCACAGAGG + Intronic
1080480911 11:32648836-32648858 AACTCCATGGCCTGGCACAGTGG - Intronic
1080532334 11:33189213-33189235 CACTCCAGGCTGGGCCACAGAGG - Intergenic
1083108668 11:60383571-60383593 CACTCCATGCTGGGTGACAGAGG - Intronic
1083460939 11:62811402-62811424 AATTTCTTGCTGTGACACACAGG + Intronic
1084669628 11:70597384-70597406 AAATCCATGGTGTGGCAAAGAGG - Intronic
1084686853 11:70701243-70701265 AACTCCAGTCTGGGACACACTGG - Intronic
1085225203 11:74913762-74913784 ACCTCCATCCTGTAACACACAGG - Intronic
1086987921 11:93270220-93270242 AAAGCCCTGCTGGGACACAGGGG - Intergenic
1087709060 11:101529116-101529138 GACTTCATTTTGTGACACAGGGG + Intronic
1088317246 11:108519915-108519937 CACTCCAGGCTGGGAGACAGAGG + Intronic
1088489762 11:110375502-110375524 ACCTCCATGCTATGACATTGAGG - Intergenic
1088528056 11:110777976-110777998 AAGTCCCTGCAGTGACTCAGAGG + Intergenic
1090928970 11:131278517-131278539 AGCCCCTTGCTGAGACACAGCGG + Intergenic
1091229532 11:133978962-133978984 ACCTCCATGCTTTATCACAGAGG + Intergenic
1091465284 12:678592-678614 AACTCCCAGCTGGGGCACAGTGG - Intergenic
1091965086 12:4733884-4733906 AATTCCATGGGGTGACTCAGAGG + Intronic
1093310945 12:17583506-17583528 CACTCCAGGCTGGGAGACAGAGG + Intergenic
1099460249 12:82912270-82912292 AACGCCATGCTTTGACACCTGGG - Intronic
1099613538 12:84907312-84907334 AACTCCAGCCTGGGCCACAGAGG + Intronic
1101458423 12:104862157-104862179 AACTACATGCTGTCACAGAATGG + Intronic
1102120475 12:110436952-110436974 AAGTCCATGCTGTAAGTCAGAGG + Intronic
1102939383 12:116925692-116925714 AATTCAATGCTTTGAAACAGTGG + Intronic
1103544205 12:121688217-121688239 AACTCCAGGCTGGGCAACAGAGG - Intergenic
1104751800 12:131244822-131244844 CACTCCATGCCTTGTCACAGTGG - Intergenic
1104780093 12:131414253-131414275 CACTCCATGCCTTGTCACAGTGG + Intergenic
1105600416 13:21881607-21881629 AACTCCATGGTGTTCCCCAGTGG - Intergenic
1105797522 13:23870769-23870791 TACTCCAGCCTGTGAGACAGAGG + Intronic
1107340207 13:39397343-39397365 ACCTCCCTTCTTTGACACAGTGG - Intronic
1108355091 13:49623016-49623038 CACTCCAGGCTGGGAAACAGAGG - Intergenic
1109717736 13:66238298-66238320 AAATCCATGCTGAGAAACAATGG + Intergenic
1110756929 13:79185785-79185807 AAAGCCATGCTGGGACAAAGTGG - Intergenic
1111583396 13:90253386-90253408 AACTCCAGGCAGTGAAACACAGG - Intergenic
1118397448 14:65349411-65349433 AGCTCCATGCGGGGACATAGTGG - Intergenic
1118709724 14:68509341-68509363 AGGACCATGCTGTGACTCAGAGG + Intronic
1119287921 14:73471107-73471129 CACTCCAGCCTGTGACAGAGTGG - Intergenic
1119536391 14:75406252-75406274 AGCTCCATGGTATGACACTGAGG + Intergenic
1120096890 14:80399320-80399342 AACTCCATGTTGTGATGCTGGGG - Intergenic
1121307985 14:92918770-92918792 AACCCAATGCTGGGACCCAGGGG + Intergenic
1124072035 15:26404340-26404362 AACTCCAGGCTGTCAGAAAGTGG - Intergenic
1127635032 15:60860943-60860965 CACTCCCAGCTGGGACACAGGGG - Intronic
1130219751 15:82009554-82009576 AAGTCACTGCTGTGACACGGAGG - Intergenic
1131196494 15:90359486-90359508 CACTCCAGGCTGGGAGACAGAGG - Intronic
1131236527 15:90701687-90701709 CACTCCAGGCTGGGCCACAGAGG + Intergenic
1132093126 15:98961633-98961655 AATTCCATGATGTGCCTCAGTGG - Exonic
1132403828 15:101530335-101530357 AACTCCCTGCTGAGTCACTGTGG - Intergenic
1136370769 16:29834632-29834654 CACTCCATCCTGGGCCACAGAGG + Intronic
1136733924 16:32445315-32445337 AATTCAATGCTGTTACACAACGG - Intergenic
1137238142 16:46632606-46632628 AACTCGATGCGGGGCCACAGAGG - Intergenic
1138164615 16:54789511-54789533 CACTCCAGCCTGTGAGACAGAGG - Intergenic
1139517936 16:67462792-67462814 CACTCCAGCCTGTGAGACAGAGG + Intronic
1140321340 16:73954688-73954710 AACTCCAGGCTGGGACATGGAGG - Intergenic
1140541325 16:75758827-75758849 AACACCAAGCTGTGACTCATGGG - Intronic
1140900427 16:79361835-79361857 AAGTCCAGGCTGTTACAGAGAGG + Intergenic
1142205602 16:88781539-88781561 AGCTCCCTGGTGTGACAGAGGGG - Intronic
1203019158 16_KI270728v1_random:384284-384306 AATTCAATGCTGTTACACAACGG + Intergenic
1203037493 16_KI270728v1_random:657442-657464 AATTCAATGCTGTTACACAACGG + Intergenic
1143089790 17:4442885-4442907 AAATCATTTCTGTGACACAGTGG - Intronic
1145771604 17:27497240-27497262 AACTCCATACAGAGAAACAGAGG + Intronic
1146349118 17:32080804-32080826 CACTCCAGCCTGGGACACAGAGG - Intergenic
1146615089 17:34350196-34350218 AGCTGCAAGCTGTGACACATGGG - Intergenic
1149756799 17:59193253-59193275 AGCTCCATGAGGTGACACACAGG + Intronic
1151129564 17:71882413-71882435 AACCCCATGCAGTGACCAAGTGG + Intergenic
1151459222 17:74244826-74244848 AACCCCAGGCTTTGATACAGTGG + Intronic
1152760575 17:82105213-82105235 AAGTCCATTCTGTGGCACAGAGG + Intronic
1156821426 18:41377519-41377541 AACTCTATGCTGCAACACAGAGG - Intergenic
1157209698 18:45731231-45731253 AGCTCCCTTCTGAGACACAGGGG + Intronic
1157825223 18:50806298-50806320 AGCTGCCTGCTGTGACAGAGTGG + Intronic
1159105550 18:63999425-63999447 AACTCAATGCTGTTCCACATGGG + Intronic
1161397374 19:4051950-4051972 AACGCCCTGCTGTGACTCAGAGG + Intronic
1164573094 19:29388027-29388049 AACTCCAGTCTGGAACACAGGGG - Intergenic
1165773393 19:38390736-38390758 AACCCCAGGCTGTTCCACAGGGG + Intronic
1168134880 19:54343839-54343861 CACTCCATGCTGGGTGACAGAGG + Intergenic
925344475 2:3160940-3160962 TCCTCCATGCAGTGACTCAGGGG + Intergenic
925779499 2:7369350-7369372 AACTCCACACTGTGAAAAAGGGG + Intergenic
926621408 2:15049735-15049757 GTCCCCATGCTGGGACACAGTGG - Intergenic
928213963 2:29345755-29345777 AACACCCTTGTGTGACACAGGGG - Intronic
930537765 2:52665975-52665997 ACCTCCATCCCTTGACACAGGGG + Intergenic
930637058 2:53818026-53818048 AACTCTATAATGAGACACAGTGG - Exonic
931018483 2:58014056-58014078 AAATCCCTGCTGTGAGAAAGTGG - Intronic
932893338 2:75614709-75614731 AACTCCATTCTGAGTAACAGAGG - Intergenic
934311820 2:91874110-91874132 AATTCAATGCTGTTACACAACGG + Intergenic
935729580 2:106054431-106054453 AACTCCATGCTGTGACGTTATGG - Intergenic
935972602 2:108544861-108544883 ATCTCTATGATATGACACAGGGG - Intronic
937207277 2:120244883-120244905 AGCTTCAGGCTGTGATACAGTGG + Intronic
940122709 2:150284887-150284909 CACTCCATCCTGGGCCACAGAGG - Intergenic
942034485 2:171997705-171997727 CACTCCAGCCTGTGCCACAGAGG - Intronic
942610805 2:177740692-177740714 AATTCCATGCTGTGCTGCAGTGG - Intronic
943604083 2:189955775-189955797 AACACCATCATGTGACAAAGTGG + Intronic
945375429 2:209074382-209074404 AACTGGATGCTGTGTTACAGTGG - Intergenic
946143387 2:217710895-217710917 AACTACAGGCTGTAACACAAGGG + Intronic
947576779 2:231281453-231281475 AACTCCTTGGTGTGGCACACAGG - Intronic
947850407 2:233283162-233283184 AACTCCAAGCTGAGAAAGAGGGG + Intronic
948540417 2:238687414-238687436 AAAACCAAGCTATGACACAGAGG + Intergenic
1170102572 20:12718672-12718694 AACTCCTTGCTCTGGCTCAGTGG + Intergenic
1171205071 20:23272733-23272755 CACTCCATGCTGTGCTGCAGCGG - Intergenic
1173657682 20:44711678-44711700 AAATCCATGCTCTGACTCAGAGG + Intergenic
1173960416 20:47066993-47067015 AAATCCATCCTGTGCCAGAGAGG - Intronic
1174744497 20:53048152-53048174 GAGTCCATGTTGTGACACTGTGG - Intronic
1175736667 20:61391981-61392003 ATCTCCATGCTGAGTCACTGGGG - Intronic
1176852020 21:13926964-13926986 AACTCCAGCCTGGGAGACAGAGG + Intergenic
1177654634 21:24002065-24002087 ATTTCCAAACTGTGACACAGAGG - Intergenic
1179161905 21:38906009-38906031 AACTCCAGGCGGTAACACACTGG + Intergenic
1180538577 22:16419933-16419955 AATTCAATGCTGTTACACAACGG + Intergenic
1181688354 22:24544210-24544232 AACTCCCTGCTCTGTCACTGTGG + Intronic
1184828790 22:46970951-46970973 GACTCCAGGCTGTGACAGCGGGG - Intronic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
950248419 3:11443012-11443034 AACTTCATAGTGTGAAACAGTGG + Intronic
951383317 3:22012733-22012755 AATCCTATGCTGTAACACAGTGG - Intronic
953574862 3:44104887-44104909 AACTCTAGGCTGAGGCACAGAGG - Intergenic
954432661 3:50479540-50479562 ACCTCCAAGGGGTGACACAGAGG + Intronic
955521013 3:59775702-59775724 AACTTCTGGCTGTGACAAAGGGG - Intronic
956437737 3:69250509-69250531 ATAACCATGCTGTAACACAGGGG - Intronic
959595486 3:108124650-108124672 AACTCCATGCTGCAACACAGAGG + Intergenic
961907151 3:130274751-130274773 AACTCCATCCTGTGTCCCTGGGG - Intergenic
962680970 3:137800081-137800103 ATCTCCATTCTCTGACAGAGGGG - Intergenic
966326439 3:178761168-178761190 ATCTCCATGCTTAGACAAAGAGG + Intronic
969241219 4:5899426-5899448 AGCTCCAGGCTCTGCCACAGCGG + Intronic
978463155 4:108980014-108980036 AACTCCTTTCTCTGACAGAGTGG - Intronic
980630671 4:135427538-135427560 CACTCCATGCTGGGCAACAGAGG + Intergenic
981398742 4:144286695-144286717 AATTCCATGATGTGACAGAGAGG - Intergenic
981651349 4:147062587-147062609 TATTCCATCCTATGACACAGAGG - Intergenic
982611285 4:157576772-157576794 AACTCCATGCTGGTCTACAGTGG - Intergenic
983737964 4:171087225-171087247 CACTCCAGGCTGAGAGACAGAGG + Intergenic
985893621 5:2736139-2736161 AATGCCAAGGTGTGACACAGGGG - Intergenic
986311412 5:6553592-6553614 AACTCCATGCTGAGTGACAGAGG - Intergenic
989054002 5:37348531-37348553 AATGGCATTCTGTGACACAGAGG + Exonic
989786578 5:45339526-45339548 AACTCCTTCATATGACACAGAGG - Intronic
992497549 5:77308669-77308691 AACTCCATGCTGTGACACAGTGG + Intronic
993789416 5:92189502-92189524 CACTCCAGCCTGGGACACAGAGG - Intergenic
996624208 5:125550563-125550585 AACTCCATGCTGTTAAAAAGTGG + Intergenic
999759151 5:154687011-154687033 AGCACCATGCTGTGACTGAGGGG - Intergenic
1000848373 5:166309843-166309865 CACTCCATGCCCTGAAACAGCGG + Intergenic
1001255239 5:170178207-170178229 CTCTCCATGATGTGGCACAGTGG - Intergenic
1002949814 6:1798841-1798863 AACTGCAGGCTATGACACACTGG + Intronic
1004243824 6:13953299-13953321 CATTCCATTCAGTGACACAGTGG + Intronic
1004393839 6:15231269-15231291 CACTCCATGCTGGGAGACAGAGG - Intergenic
1004916278 6:20334996-20335018 AATGGCATGCTGTGAAACAGAGG - Intergenic
1005562786 6:27057865-27057887 AACTCCAGCCTGTGTAACAGAGG + Intergenic
1006557454 6:34880019-34880041 AACAACATTCTGAGACACAGAGG + Exonic
1006801719 6:36764157-36764179 AACTTCATGGTGGGACCCAGTGG + Intronic
1008279695 6:49582159-49582181 CACTCCAGCCTGTGAAACAGAGG - Intergenic
1013675260 6:112453007-112453029 AACTGGATGCTGAGATACAGGGG - Intergenic
1017506310 6:155071860-155071882 CACTCCATGCTGGGCAACAGAGG + Intronic
1019807491 7:3138770-3138792 AACTTCATGCTGGGAGACAGTGG + Intergenic
1022658798 7:32346735-32346757 AACACCATGCAGTAACAAAGAGG + Intergenic
1024029378 7:45444977-45444999 GACTCCAGGCTGTGGCAGAGTGG - Intergenic
1024548046 7:50538765-50538787 AAATCCATTCTGTCCCACAGAGG - Intronic
1027007277 7:74705984-74706006 AACTCCAGCCTGAGCCACAGAGG - Intronic
1028074743 7:86497935-86497957 AAGTCCATTCTGAGAAACAGCGG - Intergenic
1028449490 7:90965169-90965191 AACACCATGCAGAGACAAAGTGG - Intronic
1030891949 7:115009117-115009139 AACTACATGCTGAGAAACAAAGG - Intronic
1034501150 7:151451831-151451853 AAGTCCCTGCTGTGAGGCAGGGG + Intergenic
1039750587 8:40474700-40474722 ACCTGCATGGTGTGACTCAGAGG - Intergenic
1039972810 8:42334789-42334811 AACTCCATGACATTACACAGGGG - Intergenic
1040541751 8:48363533-48363555 AACTCCATTCTGGGTGACAGAGG + Intergenic
1046145800 8:110156797-110156819 TAATCCAAGCTGTGACACCGAGG - Intergenic
1046917512 8:119692832-119692854 AAGTCCCTCCTGTGACACATGGG - Intergenic
1048353212 8:133632634-133632656 AACTCCATCCTGGGTGACAGAGG + Intergenic
1048854386 8:138673966-138673988 AACGCCATGCAGTCACTCAGGGG + Intronic
1051462685 9:17340109-17340131 AACTCCAGCCTGGGCCACAGAGG + Intronic
1052319332 9:27150707-27150729 AACTCCATTCTGTGAGGCAGTGG - Intronic
1056021600 9:82443712-82443734 AGCACTATGGTGTGACACAGTGG + Intergenic
1056655316 9:88504001-88504023 AACTGCACGGTGTGACATAGCGG - Intergenic
1057090226 9:92251174-92251196 ACCTCCATCCTGTGAAGCAGGGG - Intronic
1058895301 9:109395751-109395773 CACTCCATCCTGGGAGACAGAGG + Intronic
1059879608 9:118675683-118675705 AACACCAAGCTGTTACACAGAGG - Intergenic
1185648429 X:1631457-1631479 ATCTCCCTCCTGTGACTCAGTGG + Intronic
1185995613 X:4945010-4945032 AACTCCCTTCTGTAACACTGGGG - Intergenic
1188373356 X:29396378-29396400 AATTTCATGCCGTGACATAGAGG + Exonic
1188726134 X:33584804-33584826 AAATCCTTACTGTAACACAGAGG + Intergenic
1193736250 X:85160035-85160057 AACTGCATGCTCTAACACTGGGG - Intergenic
1196843723 X:119881726-119881748 AACTCCATCCTGGGTGACAGAGG + Intergenic
1197654529 X:129102247-129102269 CACTCCAGCCTGTGCCACAGAGG + Intergenic
1198920811 X:141724173-141724195 AAATGCATGCAATGACACAGGGG + Intergenic
1201313706 Y:12621755-12621777 AGCTCCCTGCTGTGCCACTGGGG - Intergenic
1201616606 Y:15907329-15907351 ATGTCCATGCTGTAGCACAGTGG - Intergenic